Rmu_sc0004278.1_g000001

UPF0481 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004278.1
OG0000351
Physical Location & Seq
Reverse (-)
2385 .. 3308
924 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004278.1_g000001.1.cds

Sequence Viewer

Length: 924 bp
atgatggtggttgatggttgccttgttattgagttcatgctcggaaggacatacagcaagattcttcggaatgatcctctgtcccaaagttcatggatgcgcaccccacttatatcagatttgtttctacgggaaaaccagttgccttggttagttcttgattgtttattccaatatcttgtaaaagaaaatgctgacgatgaacctgttggaaagcataagtttctgtctgagcttactctcaaattttgtcagttgcacaccatgcgttttctaaagccaattgatggagcatccgaaatcaggcatttacttgaccacataagaattggtatagttggaccagaaaagctaaccttcagttcacgtcgttatttggttccctctgtgacagaactccggcaaattggagtcatatttaaacgtggagacatgtctgcttgccacacactcaacatagccttccacaatggagtgatggagattccggaaatatgtattggcaataatcgatctctctttatcaacctcattgccctcgaagaatgccaacaaggcctcataggttatgcatttacctcttatgccagggtcttgcattatattattaaatctaacaaagatgcagaatttctcatgcagaaaggaattatacataccactttgagcaaggaggacataacttgtctcttcaatagcattcatgataacgcaacaccgacctctgaatctgttgtaattctcaccaggaatgtgcatttgtattgtaagcgtcgttggctcaggagatgccttataagtatcaaacaggattatctatacaatccatcttcagtctggtccctttctaatgcggtcatcattattgtaattctcggcatcgcacaaaccatatacactcttctctcttactacaagtcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

307

Amino Acids

35.31

Weight (kDa)

8.66

Isoelectric Point (pI)

55.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000351)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g16420 FvH4_6g39730
malus_domestica MD02G1081100.v1.1 MD02G1081200.v1.1 MD09G1249600.v1.1 MD09G1250500.v1.1 MD09G1250900.v1.1 MD15G1081900.v1.1 MD15G1208800.v1.1 MD17G1242700.v1.1 MD17G1242800.v1.1 MD17G1242900.v1.1 MD17G1243200.v1.1
prunus_persica Prupe.3G130000_v2.0.a1 Prupe.3G130100_v2.0.a1 Prupe.3G130300_v2.0.a1 Prupe.3G130400_v2.0.a1 Prupe.3G130400_v2.0.a1 Prupe.3G130400_v2.0.a1 Prupe.3G130500_v2.0.a1 Prupe.3G136500_v2.0.a1 Prupe.3G141700_v2.0.a1 Prupe.3G141800_v2.0.a1 Prupe.3G141900_v2.0.a1 Prupe.3G155700_v2.0.a1 Prupe.7G207700_v2.0.a1 Prupe.7G207800_v2.0.a1 Prupe.7G207900_v2.0.a1 Prupe.7G207900_v2.0.a1 Prupe.7G208100_v2.0.a1 Prupe.7G208100_v2.0.a1 Prupe.7G208100_v2.0.a1 Prupe.7G208100_v2.0.a1
pyrus_communis pycom09g16640 pycom09g16690 pycom15g07650 pycom17g24550 pycom17g24560 pycom17g24570 pycom17g24670
rosa_chinensis RchiOBHm_Chr2g0153821 RchiOBHm_Chr2g0163501 RchiOBHm_Chr2g0163511 RchiOBHm_Chr2g0163521 RchiOBHm_Chr5g0063201 RchiOBHm_Chr7g0229231 RchiOBHm_Chr7g0229251
rosa_laevigata RLG00000001520 RLG00000020727 RLG00000020731 RLG00000021394 RLG00000022074 RLG00000023249
rosa_multiflora Rmu_sc0000235.1_g000044 Rmu_sc0000693.1_g000020 Rmu_sc0000693.1_g000032 Rmu_sc0002053.1_g000010 Rmu_sc0002053.1_g000011 Rmu_sc0003887.1_g000020 Rmu_sc0004278.1_g000001 Rmu_sc0012759.1_g000001
rosa_roxburghii Rroxscaffold_2G00087170 Rroxscaffold_2G00087180 Rroxscaffold_2G00087190 Rroxscaffold_2G00087230 Rroxscaffold_2G00087250 Rroxscaffold_2G00087320 Rroxscaffold_2G00094720 Rroxscaffold_3G00230450 Rroxscaffold_3G00230460
rosa_rugosa Rorug02G0442300.1 Rorug02G0442400 Rorug02G0503400 Rorug02G0503500 Rorug02G0560600 Rorug05G0355000 Rorug05G0355100 Rorug07G0258000
rosa_samantha Rh2AG185500 Rh2AG506100 Rh2AG506200 Rh2AG570300 Rh2AG570400 Rh2BG515600 Rh2BG582500 Rh2BG582600 Rh2BG582700 Rh2CG491600 Rh2CG491700 Rh2CG552300 Rh2CG552400 Rh2CG617700 Rh2CG617800 Rh2DG528100 Rh2DG592200 Rh2DG592300 Rh2DG592400 Rh2DG665500 Rh5CG234300 Rh5DG460600 Rh7AG407800 Rh7BG387600 Rh7CG426800 Rh7CG427000 Rh7DG402900
rosa_wichuraiana Rw0G001890 Rw2G041540 Rw2G047220

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 797
Acc16I TGCGCA 1 cut(s) 101
AccB7I CCANNNNNTGG 1 cut(s) 287
AccIII TCCGGA 1 cut(s) 487
AciI CCGC 1 cut(s) 854
AclWI GGATC 1 cut(s) 68
AcsI RAATTY 2 cut(s) 245, 629
AcuI CTGAAG 2 cut(s) 343, 816
AfiI CCNNNNNNNGG 2 cut(s) 287, 303
AflIII ACRYGT 1 cut(s) 432
AgsI TTSAA 1 cut(s) 694
AjiI CACGTC 1 cut(s) 368
AjnI CCWGG 2 cut(s) 587, 746
AjuI GAANNNNNNNTTGG 2 cut(s) 483, 515
AluBI AGCT 2 cut(s) 235, 352
AluI AGCT 2 cut(s) 235, 352
Alw26I GTCTC 2 cut(s) 423, 692
AlwI GGATC 1 cut(s) 68
Aor13HI TCCGGA 1 cut(s) 487
AoxI GGCC 1 cut(s) 556
ApoI RAATTY 2 cut(s) 245, 629
AspLEI GCGC 1 cut(s) 102
AspS9I GGNCC 2 cut(s) 341, 840
AsuHPI GGTGA 1 cut(s) 736
AvaII GGWCC 2 cut(s) 341, 840
BccI CCATC 4 cut(s) 8, 281, 472, 835
BciT130I CCWGG 2 cut(s) 589, 748
BcoDI GTCTC 2 cut(s) 423, 692
BglI GCCNNNNNGGC 1 cut(s) 555
Bme1390I CCNGG 2 cut(s) 589, 748
Bme18I GGWCC 2 cut(s) 341, 840
BmgBI CACGTC 1 cut(s) 368
BmgT120I GGNCC 2 cut(s) 341, 840
BmiI GGNNCC 2 cut(s) 381, 842
BmrFI CCNGG 2 cut(s) 589, 748
BmsI GCATC 5 cut(s) 87, 302, 613, 779, 888
Bpu10I CCTNAGC 1 cut(s) 782
Bsa29I ATCGAT 1 cut(s) 511
BsaJI CCNNGG 2 cut(s) 146, 588
BsaWI WCCGGW 1 cut(s) 487
Bsc4I CCNNNNNNNGG 2 cut(s) 287, 303
Bse1I ACTGG 1 cut(s) 139
Bse3DI GCAATG 1 cut(s) 531
BseAI TCCGGA 1 cut(s) 487
BseBI CCWGG 2 cut(s) 589, 748
BseCI ATCGAT 1 cut(s) 511
BseDI CCNNGG 2 cut(s) 146, 588
BseGI GGATG 2 cut(s) 102, 293
BseLI CCNNNNNNNGG 2 cut(s) 287, 303
BseMI GCAATG 1 cut(s) 531
BseMII CTCAG 2 cut(s) 222, 796
BseNI ACTGG 1 cut(s) 139
BshFI GGCC 1 cut(s) 558
BshVI ATCGAT 1 cut(s) 511
BsiSI CCGG 2 cut(s) 400, 488
BslFI GGGAC 2 cut(s) 67, 826
BslI CCNNNNNNNGG 2 cut(s) 287, 303
BsmAI GTCTC 2 cut(s) 423, 692
BsmFI GGGAC 2 cut(s) 67, 826
BsmI GAATGC 2 cut(s) 551, 699
BsnI GGCC 1 cut(s) 558
Bsp13I TCCGGA 1 cut(s) 487
Bsp143I GATC 2 cut(s) 73, 512
BspACI CCGC 1 cut(s) 854
BspANI GGCC 1 cut(s) 558
BspCNI CTCAG 2 cut(s) 223, 795
BspDI ATCGAT 1 cut(s) 511
BspEI TCCGGA 1 cut(s) 487
BspHI TCATGA 1 cut(s) 703
BspLI GGNNCC 2 cut(s) 381, 842
BspPI GGATC 1 cut(s) 68
BsrDI GCAATG 1 cut(s) 531
BsrI ACTGG 1 cut(s) 139
BssECI CCNNGG 2 cut(s) 146, 588
BssMI GATC 2 cut(s) 73, 512
BssT1I CCWWGG 1 cut(s) 146
Bst2UI CCWGG 2 cut(s) 589, 748
Bst6I CTCTTC 2 cut(s) 695, 906
BstAPI GCANNNNNTGC 1 cut(s) 265
BstC8I GCNNGC 1 cut(s) 442
BstDEI CTNAG 2 cut(s) 231, 782
BstF5I GGATG 2 cut(s) 102, 293
BstHHI GCGC 1 cut(s) 102
BstKTI GATC 2 cut(s) 76, 515
BstMAI GTCTC 2 cut(s) 423, 692
BstMBI GATC 2 cut(s) 73, 512
BstMWI GCNNNNNNNGC 3 cut(s) 265, 555, 778
BstNI CCWGG 2 cut(s) 589, 748
BstNSI RCATGY 1 cut(s) 436
BstSCI CCNGG 2 cut(s) 587, 746
Bsu15I ATCGAT 1 cut(s) 511
BsuRI GGCC 1 cut(s) 558
BsuTUI ATCGAT 1 cut(s) 511
BtgZI GCGATG 1 cut(s) 865
BtrI CACGTC 1 cut(s) 368
BtsCI GGATG 2 cut(s) 102, 293
Cac8I GCNNGC 1 cut(s) 442
CciI TCATGA 1 cut(s) 703
CfoI GCGC 1 cut(s) 102
Cfr13I GGNCC 2 cut(s) 341, 840
ClaI ATCGAT 1 cut(s) 511
CseI GACGC 1 cut(s) 761
CviAII CATG 6 cut(s) 37, 93, 265, 433, 637, 704
CviJI RGCY 6 cut(s) 235, 280, 352, 461, 558, 781
CviKI_1 RGCY 6 cut(s) 235, 280, 352, 461, 558, 781
DdeI CTNAG 2 cut(s) 231, 782
DpnI GATC 2 cut(s) 75, 514
DpnII GATC 2 cut(s) 73, 512
DraI TTTAAA 1 cut(s) 421
Eam1104I CTCTTC 2 cut(s) 695, 906
EarI CTCTTC 2 cut(s) 695, 906
Eco130I CCWWGG 1 cut(s) 146
Eco147I AGGCCT 1 cut(s) 558
Eco47I GGWCC 2 cut(s) 341, 840
Eco57I CTGAAG 2 cut(s) 343, 816
EcoRII CCWGG 2 cut(s) 587, 746
EcoT14I CCWWGG 1 cut(s) 146
EcoT22I ATGCAT 1 cut(s) 574
ErhI CCWWGG 1 cut(s) 146
FaeI CATG 6 cut(s) 40, 96, 268, 436, 640, 707
FalI AAGNNNNNCTT 2 cut(s) 341, 373
FaqI GGGAC 2 cut(s) 67, 826
FatI CATG 6 cut(s) 36, 92, 264, 432, 636, 703
FokI GGATG 2 cut(s) 109, 280
FspAI RTGCGCAY 1 cut(s) 101
FspI TGCGCA 1 cut(s) 101
GlaI GCGC 1 cut(s) 101
HaeIII GGCC 1 cut(s) 558
HapII CCGG 2 cut(s) 400, 488
HgaI GACGC 1 cut(s) 761
HhaI GCGC 1 cut(s) 102
Hin1II CATG 6 cut(s) 40, 96, 268, 436, 640, 707
Hin6I GCGC 1 cut(s) 100
HinP1I GCGC 1 cut(s) 100
HinfI GANTC 4 cut(s) 61, 411, 484, 728
HpaII CCGG 2 cut(s) 400, 488
HphI GGTGA 1 cut(s) 736
Hpy166II GTNNAC 1 cut(s) 365
Hpy188I TCNGA 6 cut(s) 44, 69, 118, 232, 298, 727
Hpy188III TCNNGA 4 cut(s) 158, 488, 704, 784
Hpy8I GTNNAC 1 cut(s) 365
Hpy99I CGWCG 2 cut(s) 372, 777
HpyAV CCTTC 3 cut(s) 39, 367, 472
HpyCH4IV ACGT 2 cut(s) 367, 424
HpyCH4V TGCA 6 cut(s) 259, 572, 598, 626, 640, 757
HpyF10VI GCNNNNNNNGC 3 cut(s) 265, 555, 778
HpyF3I CTNAG 2 cut(s) 231, 782
HpySE526I ACGT 2 cut(s) 367, 424
Hsp92II CATG 6 cut(s) 40, 96, 268, 436, 640, 707
HspAI GCGC 1 cut(s) 100
Kpn2I TCCGGA 1 cut(s) 487
Kzo9I GATC 2 cut(s) 73, 512
LmnI GCTCC 1 cut(s) 290
LweI GCATC 5 cut(s) 87, 302, 613, 779, 888
MaeII ACGT 2 cut(s) 367, 424
MaeIII GTNAC 1 cut(s) 388
MalI GATC 2 cut(s) 75, 514
MboI GATC 2 cut(s) 73, 512
MboII GAAGA 5 cut(s) 56, 554, 682, 822, 893
MfeI CAATTG 1 cut(s) 282
MluCI AATT 8 cut(s) 245, 282, 327, 405, 629, 648, 738, 870
MlyI GAGTC 1 cut(s) 420
MmeI TCCRAC 2 cut(s) 190, 319
MnlI CCTC 8 cut(s) 87, 394, 539, 548, 569, 589, 667, 733
Mph1103I ATGCAT 1 cut(s) 574
MroI TCCGGA 1 cut(s) 487
MseI TTAA 2 cut(s) 420, 609
MspI CCGG 2 cut(s) 400, 488
MspR9I CCNGG 2 cut(s) 589, 748
MunI CAATTG 1 cut(s) 282
Mva1269I GAATGC 2 cut(s) 551, 699
MvaI CCWGG 2 cut(s) 589, 748
MwoI GCNNNNNNNGC 3 cut(s) 265, 555, 778
NdeII GATC 2 cut(s) 73, 512
NlaIII CATG 6 cut(s) 40, 96, 268, 436, 640, 707
NlaIV GGNNCC 2 cut(s) 381, 842
NmeAIII GCCGAG 1 cut(s) 855
NmuCI GTSAC 1 cut(s) 388
NsbI TGCGCA 1 cut(s) 101
NsiI ATGCAT 1 cut(s) 574
NspI RCATGY 1 cut(s) 436
PagI TCATGA 1 cut(s) 703
PceI AGGCCT 1 cut(s) 558
PciI ACATGT 1 cut(s) 432
PctI GAATGC 2 cut(s) 551, 699
PfeI GAWTC 3 cut(s) 61, 484, 728
PflMI CCANNNNNTGG 1 cut(s) 287
PleI GAGTC 1 cut(s) 419
PpsI GAGTC 1 cut(s) 419
PscI ACATGT 1 cut(s) 432
PsiI TTATAA 1 cut(s) 797
Psp6I CCWGG 2 cut(s) 587, 746
PspGI CCWGG 2 cut(s) 587, 746
PspN4I GGNNCC 2 cut(s) 381, 842
PspPI GGNCC 2 cut(s) 341, 840
SaqAI TTAA 2 cut(s) 420, 609
Sau3AI GATC 2 cut(s) 73, 512
Sau96I GGNCC 2 cut(s) 341, 840
SchI GAGTC 1 cut(s) 420
ScrFI CCNGG 2 cut(s) 589, 748
SfaNI GCATC 5 cut(s) 87, 302, 613, 779, 888
SinI GGWCC 2 cut(s) 341, 840
Sse9I AATT 8 cut(s) 245, 282, 327, 405, 629, 648, 738, 870
SseBI AGGCCT 1 cut(s) 558
SsiI CCGC 1 cut(s) 854
StuI AGGCCT 1 cut(s) 558
StyD4I CCNGG 2 cut(s) 587, 746
StyI CCWWGG 1 cut(s) 146
TaiI ACGT 2 cut(s) 370, 427
TaqI TCGA 2 cut(s) 511, 540
TasI AATT 8 cut(s) 245, 282, 327, 405, 629, 648, 738, 870
TfiI GAWTC 3 cut(s) 61, 484, 728
Tru1I TTAA 2 cut(s) 420, 609
Tru9I TTAA 2 cut(s) 420, 609
TseFI GTSAC 1 cut(s) 388
Tsp45I GTSAC 1 cut(s) 388
TspDTI ATGAA 4 cut(s) 25, 81, 216, 692
Van91I CCANNNNNTGG 1 cut(s) 287
VpaK11BI GGWCC 2 cut(s) 341, 840
XapI RAATTY 2 cut(s) 245, 629
XceI RCATGY 1 cut(s) 436
XcmI CCANNNNNNNNNTGG 2 cut(s) 326, 834
Zsp2I ATGCAT 1 cut(s) 574
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.