Rh2DG592300

UPF0481 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0000351
Physical Location & Seq
Forward (+)
82468412 .. 82468642
231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG592300.1

Sequence Viewer

Length: 231 bp
ATGGAAGGAATTAAACTATGGTACTTTCGTTCCCTCCTTCATCGAACACCAACTCCTGAAACCAGTTTGGAGCATTTGGTCAAAAGTATTAGAGCCATAGAACAACTTTGTCGCGATTGCTATGACGAGGAAAGTAATCTGAGTAGTGATCAGTTTGTAGAAGTGATGGTGGTTGATGGTTGCTTCATCGTTGAATTCATGCTCAAGACAGAACGTAGAGAGTGCGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

76

Amino Acids

9.02

Weight (kDa)

4.81

Isoelectric Point (pI)

50.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 1 - 73 1.4e-18 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000351)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g16420 FvH4_6g39730
malus_domestica MD02G1081100.v1.1 MD02G1081200.v1.1 MD09G1249600.v1.1 MD09G1250500.v1.1 MD09G1250900.v1.1 MD15G1081900.v1.1 MD15G1208800.v1.1 MD17G1242700.v1.1 MD17G1242800.v1.1 MD17G1242900.v1.1 MD17G1243200.v1.1
prunus_persica Prupe.3G130000_v2.0.a1 Prupe.3G130100_v2.0.a1 Prupe.3G130300_v2.0.a1 Prupe.3G130400_v2.0.a1 Prupe.3G130400_v2.0.a1 Prupe.3G130400_v2.0.a1 Prupe.3G130500_v2.0.a1 Prupe.3G136500_v2.0.a1 Prupe.3G141700_v2.0.a1 Prupe.3G141800_v2.0.a1 Prupe.3G141900_v2.0.a1 Prupe.3G155700_v2.0.a1 Prupe.7G207700_v2.0.a1 Prupe.7G207800_v2.0.a1 Prupe.7G207900_v2.0.a1 Prupe.7G207900_v2.0.a1 Prupe.7G208100_v2.0.a1 Prupe.7G208100_v2.0.a1 Prupe.7G208100_v2.0.a1 Prupe.7G208100_v2.0.a1
pyrus_communis pycom09g16640 pycom09g16690 pycom15g07650 pycom17g24550 pycom17g24560 pycom17g24570 pycom17g24670
rosa_chinensis RchiOBHm_Chr2g0153821 RchiOBHm_Chr2g0163501 RchiOBHm_Chr2g0163511 RchiOBHm_Chr2g0163521 RchiOBHm_Chr5g0063201 RchiOBHm_Chr7g0229231 RchiOBHm_Chr7g0229251
rosa_laevigata RLG00000001520 RLG00000020727 RLG00000020731 RLG00000021394 RLG00000022074 RLG00000023249
rosa_multiflora Rmu_sc0000235.1_g000044 Rmu_sc0000693.1_g000020 Rmu_sc0000693.1_g000032 Rmu_sc0002053.1_g000010 Rmu_sc0002053.1_g000011 Rmu_sc0003887.1_g000020 Rmu_sc0004278.1_g000001 Rmu_sc0012759.1_g000001
rosa_roxburghii Rroxscaffold_2G00087170 Rroxscaffold_2G00087180 Rroxscaffold_2G00087190 Rroxscaffold_2G00087230 Rroxscaffold_2G00087250 Rroxscaffold_2G00087320 Rroxscaffold_2G00094720 Rroxscaffold_3G00230450 Rroxscaffold_3G00230460
rosa_rugosa Rorug02G0442300.1 Rorug02G0442400 Rorug02G0503400 Rorug02G0503500 Rorug02G0560600 Rorug05G0355000 Rorug05G0355100 Rorug07G0258000
rosa_samantha Rh2AG185500 Rh2AG506100 Rh2AG506200 Rh2AG570300 Rh2AG570400 Rh2BG515600 Rh2BG582500 Rh2BG582600 Rh2BG582700 Rh2CG491600 Rh2CG491700 Rh2CG552300 Rh2CG552400 Rh2CG617700 Rh2CG617800 Rh2DG528100 Rh2DG592200 Rh2DG592300 Rh2DG592400 Rh2DG665500 Rh5CG234300 Rh5DG460600 Rh7AG407800 Rh7BG387600 Rh7CG426800 Rh7CG427000 Rh7DG402900
rosa_wichuraiana Rw0G001890 Rw2G041540 Rw2G047220

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 114
AcsI RAATTY 1 cut(s) 194
AfaI GTAC 1 cut(s) 23
AgsI TTSAA 1 cut(s) 194
AloI GAACNNNNNNTCC 2 cut(s) 37, 69
ApoI RAATTY 1 cut(s) 194
BaeI ACNNNNGTAYC 2 cut(s) 13, 46
BccI CCATC 2 cut(s) 160, 170
BclI TGATCA 1 cut(s) 148
BpuEI CTTGAG 1 cut(s) 188
BsaXI ACNNNNNCTCC 2 cut(s) 37, 67
Bse1I ACTGG 1 cut(s) 63
BseMII CTCAG 1 cut(s) 131
BseNI ACTGG 1 cut(s) 63
Bsh1236I CGCG 1 cut(s) 114
Bsp143I GATC 1 cut(s) 148
Bsp68I TCGCGA 1 cut(s) 114
BspCNI CTCAG 1 cut(s) 132
BspFNI CGCG 1 cut(s) 114
BsrI ACTGG 1 cut(s) 63
BssMI GATC 1 cut(s) 148
BstDEI CTNAG 1 cut(s) 140
BstFNI CGCG 1 cut(s) 114
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstUI CGCG 1 cut(s) 114
BtuMI TCGCGA 1 cut(s) 114
Csp6I GTAC 1 cut(s) 22
CviAII CATG 1 cut(s) 199
CviJI RGCY 1 cut(s) 95
CviKI_1 RGCY 1 cut(s) 95
CviQI GTAC 1 cut(s) 22
DdeI CTNAG 1 cut(s) 140
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
EcoRI GAATTC 1 cut(s) 194
FaeI CATG 1 cut(s) 202
FaiI YATR 4 cut(s) 19, 98, 123, 200
FatI CATG 1 cut(s) 198
FbaI TGATCA 1 cut(s) 148
Hin1II CATG 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 141
Hpy188III TCNNGA 3 cut(s) 56, 113, 205
HpyAV CCTTC 1 cut(s) 47
HpyCH4IV ACGT 1 cut(s) 214
HpyF3I CTNAG 1 cut(s) 140
HpySE526I ACGT 1 cut(s) 214
Hsp92II CATG 1 cut(s) 202
Ksp22I TGATCA 1 cut(s) 148
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 70
LpnPI CCDG 2 cut(s) 69, 76
MaeII ACGT 1 cut(s) 214
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MluCI AATT 2 cut(s) 9, 194
MnlI CCTC 2 cut(s) 44, 121
MseI TTAA 1 cut(s) 12
MvnI CGCG 1 cut(s) 114
NdeII GATC 1 cut(s) 148
NlaIII CATG 1 cut(s) 202
NruI TCGCGA 1 cut(s) 114
RruI TCGCGA 1 cut(s) 114
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
SaqAI TTAA 1 cut(s) 12
Sau3AI GATC 1 cut(s) 148
SetI ASST 1 cut(s) 217
SgeI CNNG 6 cut(s) 68, 75, 125, 139, 211, 217
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 2 cut(s) 9, 194
TaiI ACGT 1 cut(s) 217
TaqI TCGA 1 cut(s) 43
TasI AATT 2 cut(s) 9, 194
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TspDTI ATGAA 3 cut(s) 29, 175, 187
XapI RAATTY 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.