Rmu_sc0009241.1_g000001

CMP-sialic acid transporter

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009241.1
Physical Location & Seq
Reverse (-)
3914 .. 4626
713 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009241.1_g000001.1.cds

Sequence Viewer

Length: 216 bp
atgagccacgccaagagaagcgttctcaggactgtgccgatgaagccgaatttcgtcgagcggaaaccctcgccggttgtcaccacctccaccggcaagtgcgttagttaccttcagaatgacagagacggtagcttgaagaaggcctacaaagagtggactttggttggtgcattgaccgcttctcggcttcccactaccatttatgcactctag
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.9

Weight (kDa)

10.17

Isoelectric Point (pI)

38.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000372)

Species Orthologous Gene IDs
pyrus_communis pycom04g09000
rosa_chinensis RchiOBHm_Chr1g0319921 RchiOBHm_Chr2g0124671 RchiOBHm_Chr3g0488631 RchiOBHm_Chr3g0495191 RchiOBHm_Chr5g0067451 RchiOBHm_Chr6g0269581 RchiOBHm_Chr7g0210411 RchiOBHm_Chr7g0212341 RchiOBHm_Chr7g0214191
rosa_laevigata RLG00000003882 RLG00000008030 RLG00000011591 RLG00000016235 RLG00000018631 RLG00000031951 RLG00000032135 RLG00000032548 RLG00000033239
rosa_multiflora Rmu_sc0000281.1_g000015 Rmu_sc0000516.1_g000020 Rmu_sc0000816.1_g000025 Rmu_sc0001850.1_g000002 Rmu_sc0003260.1_g000025 Rmu_sc0007581.1_g000007 Rmu_sc0009241.1_g000001
rosa_roxburghii Rroxscaffold_3G00218290 Rroxscaffold_3G00240930 Rroxscaffold_4G00300430 Rroxscaffold_5G00334810 Rroxscaffold_5G00360330 Rroxscaffold_7G00180190 Rroxscaffold_7G00192890
rosa_rugosa Rorug01G0357800 Rorug01G0357900 Rorug03G0350400 Rorug05G0174000 Rorug05G0231100 Rorug05G0231100 Rorug05G0231200 Rorug05G0231200 Rorug05G0577100 Rorug07G0029800 Rorug07G0029900 Rorug07G0146200
rosa_samantha Rh1AG039300 Rh1AG155100 Rh1AG173000 Rh1AG200900 Rh1AG276400 Rh1BG055400 Rh1BG111700 Rh1CG081000 Rh1CG161100 Rh1CG161200 Rh1CG247000 Rh1CG264000 Rh1DG031600 Rh1DG163400 Rh2AG236000 Rh2AG236100 Rh2AG277400 Rh2AG277500 Rh2AG309700 Rh2AG339600 Rh2BG221000 Rh2DG243300 Rh2DG243400 Rh2DG267900 Rh2DG434000 Rh3AG280300 Rh3AG288700 Rh3CG224100 Rh4AG043200 Rh4AG260400 Rh4BG266100 Rh4CG071300 Rh4DG155900 Rh5AG213100 Rh5AG238500 Rh5AG238600 Rh5AG296300 Rh5AG463800 Rh5CG236400 Rh5CG269500 Rh5CG269600 Rh5DG131600 Rh6AG074700 Rh6AG077500 Rh6AG093000 Rh6AG286000 Rh6CG246600 Rh7AG171100 Rh7AG303600 Rh7AG389400 Rh7AG390000 Rh7AG446200 Rh7CG251500 Rh7CG408700 Rh7DG385600
rosa_wichuraiana Rw0G014360 Rw0G015950 Rw2G017860 Rw2G027110 Rw4G037790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 61
AciI CCGC 2 cut(s) 61, 180
AcsI RAATTY 1 cut(s) 49
AcuI CTGAAG 1 cut(s) 98
AfiI CCNNNNNNNGG 1 cut(s) 186
AgsI TTSAA 1 cut(s) 139
AluBI AGCT 1 cut(s) 135
AluI AGCT 1 cut(s) 135
Alw26I GTCTC 1 cut(s) 120
AoxI GGCC 1 cut(s) 144
ApoI RAATTY 1 cut(s) 49
AsuHPI GGTGA 1 cut(s) 73
BarI GAAGNNNNNNTAC 2 cut(s) 131, 163
BcoDI GTCTC 1 cut(s) 120
BfaI CTAG 1 cut(s) 214
Bsc4I CCNNNNNNNGG 1 cut(s) 186
Bse118I RCCGGY 2 cut(s) 73, 92
BseLI CCNNNNNNNGG 1 cut(s) 186
BseMII CTCAG 1 cut(s) 40
BshFI GGCC 1 cut(s) 146
BsiSI CCGG 2 cut(s) 74, 93
BslI CCNNNNNNNGG 1 cut(s) 186
BsmAI GTCTC 1 cut(s) 120
BsmBI CGTCTC 1 cut(s) 120
BsnI GGCC 1 cut(s) 146
BspACI CCGC 2 cut(s) 61, 180
BspANI GGCC 1 cut(s) 146
BspCNI CTCAG 1 cut(s) 39
BsrBI CCGCTC 1 cut(s) 61
BsrFI RCCGGY 2 cut(s) 73, 92
BssAI RCCGGY 2 cut(s) 73, 92
Bst4CI ACNGT 2 cut(s) 34, 131
BstDEI CTNAG 1 cut(s) 26
BstMAI GTCTC 1 cut(s) 120
BstMWI GCNNNNNNNGC 2 cut(s) 43, 179
BsuRI GGCC 1 cut(s) 146
Cfr10I RCCGGY 2 cut(s) 73, 92
CviJI RGCY 5 cut(s) 6, 46, 135, 146, 190
CviKI_1 RGCY 5 cut(s) 6, 46, 135, 146, 190
DdeI CTNAG 1 cut(s) 26
Eco147I AGGCCT 1 cut(s) 146
Eco57I CTGAAG 1 cut(s) 98
Esp3I CGTCTC 1 cut(s) 120
FaiI YATR 1 cut(s) 207
FspBI CTAG 1 cut(s) 214
HaeIII GGCC 1 cut(s) 146
HapII CCGG 2 cut(s) 74, 93
HpaII CCGG 2 cut(s) 74, 93
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 1 cut(s) 159
Hpy188I TCNGA 1 cut(s) 117
Hpy188III TCNNGA 1 cut(s) 28
Hpy8I GTNNAC 1 cut(s) 159
Hpy99I CGWCG 1 cut(s) 59
HpyAV CCTTC 2 cut(s) 122, 136
HpyCH4III ACNGT 2 cut(s) 34, 131
HpyCH4V TGCA 2 cut(s) 173, 209
HpyF10VI GCNNNNNNNGC 2 cut(s) 43, 179
HpyF3I CTNAG 1 cut(s) 26
LpnPI CCDG 3 cut(s) 13, 87, 106
MaeI CTAG 1 cut(s) 214
MaeIII GTNAC 2 cut(s) 79, 107
MbiI CCGCTC 1 cut(s) 61
MboII GAAGA 1 cut(s) 151
MluCI AATT 1 cut(s) 49
MnlI CCTC 2 cut(s) 79, 97
MspI CCGG 2 cut(s) 74, 93
MwoI GCNNNNNNNGC 2 cut(s) 43, 179
NmeAIII GCCGAG 1 cut(s) 166
NmuCI GTSAC 1 cut(s) 79
PceI AGGCCT 1 cut(s) 146
SetI ASST 3 cut(s) 89, 114, 137
Sse9I AATT 1 cut(s) 49
SseBI AGGCCT 1 cut(s) 146
SsiI CCGC 2 cut(s) 61, 180
SspMI CTAG 1 cut(s) 214
StuI AGGCCT 1 cut(s) 146
TaaI ACNGT 2 cut(s) 34, 131
TaqI TCGA 1 cut(s) 57
TasI AATT 1 cut(s) 49
TseFI GTSAC 1 cut(s) 79
Tsp45I GTSAC 1 cut(s) 79
TspDTI ATGAA 1 cut(s) 56
XapI RAATTY 1 cut(s) 49
XspI CTAG 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.