Rh6AG077500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0000372
Physical Location & Seq
Forward (+)
11258359 .. 11258684
326 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG077500.1

Sequence Viewer

Length: 210 bp
ATGGGGGCAGTCCAGTATCGGGCAAGTCCTATGGTGGTGGTTTGGATTTTGGAGATGAAGAAGCAGCTGAATGAAAGAGGTAGTGATGATGAAGCAACAAGTGAGGATGGGGACTATGATCCTGAATTCGATGATGATGAATATGATTATCATGGAACTGATGAGGATGACTGGTTGGTGGAAGCTGAGATGGTAAAAGAGATGGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

8.07

Weight (kDa)

4.05

Isoelectric Point (pI)

35.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000372)

Species Orthologous Gene IDs
pyrus_communis pycom04g09000
rosa_chinensis RchiOBHm_Chr1g0319921 RchiOBHm_Chr2g0124671 RchiOBHm_Chr3g0488631 RchiOBHm_Chr3g0495191 RchiOBHm_Chr5g0067451 RchiOBHm_Chr6g0269581 RchiOBHm_Chr7g0210411 RchiOBHm_Chr7g0212341 RchiOBHm_Chr7g0214191
rosa_laevigata RLG00000003882 RLG00000008030 RLG00000011591 RLG00000016235 RLG00000018631 RLG00000031951 RLG00000032135 RLG00000032548 RLG00000033239
rosa_multiflora Rmu_sc0000281.1_g000015 Rmu_sc0000516.1_g000020 Rmu_sc0000816.1_g000025 Rmu_sc0001850.1_g000002 Rmu_sc0003260.1_g000025 Rmu_sc0007581.1_g000007 Rmu_sc0009241.1_g000001
rosa_roxburghii Rroxscaffold_3G00218290 Rroxscaffold_3G00240930 Rroxscaffold_4G00300430 Rroxscaffold_5G00334810 Rroxscaffold_5G00360330 Rroxscaffold_7G00180190 Rroxscaffold_7G00192890
rosa_rugosa Rorug01G0357800 Rorug01G0357900 Rorug03G0350400 Rorug05G0174000 Rorug05G0231100 Rorug05G0231100 Rorug05G0231200 Rorug05G0231200 Rorug05G0577100 Rorug07G0029800 Rorug07G0029900 Rorug07G0146200
rosa_samantha Rh1AG039300 Rh1AG155100 Rh1AG173000 Rh1AG200900 Rh1AG276400 Rh1BG055400 Rh1BG111700 Rh1CG081000 Rh1CG161100 Rh1CG161200 Rh1CG247000 Rh1CG264000 Rh1DG031600 Rh1DG163400 Rh2AG236000 Rh2AG236100 Rh2AG277400 Rh2AG277500 Rh2AG309700 Rh2AG339600 Rh2BG221000 Rh2DG243300 Rh2DG243400 Rh2DG267900 Rh2DG434000 Rh3AG280300 Rh3AG288700 Rh3CG224100 Rh4AG043200 Rh4AG260400 Rh4BG266100 Rh4CG071300 Rh4DG155900 Rh5AG213100 Rh5AG238500 Rh5AG238600 Rh5AG296300 Rh5AG463800 Rh5CG236400 Rh5CG269500 Rh5CG269600 Rh5DG131600 Rh6AG074700 Rh6AG077500 Rh6AG093000 Rh6AG286000 Rh6CG246600 Rh7AG171100 Rh7AG303600 Rh7AG389400 Rh7AG390000 Rh7AG446200 Rh7CG251500 Rh7CG408700 Rh7DG385600
rosa_wichuraiana Rw0G014360 Rw0G015950 Rw2G017860 Rw2G027110 Rw4G037790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 113
AcsI RAATTY 1 cut(s) 125
AfiI CCNNNNNNNGG 1 cut(s) 19
AluBI AGCT 2 cut(s) 67, 185
AluI AGCT 2 cut(s) 67, 185
AlwI GGATC 1 cut(s) 113
ApeKI GCWGC 1 cut(s) 64
ApoI RAATTY 1 cut(s) 125
BbvI GCAGC 1 cut(s) 76
BccI CCATC 3 cut(s) 101, 184, 196
BisI GCNGC 1 cut(s) 65
BlsI GCNGC 1 cut(s) 66
Bsc4I CCNNNNNNNGG 1 cut(s) 19
Bse1I ACTGG 2 cut(s) 13, 176
BseGI GGATG 2 cut(s) 112, 172
BseLI CCNNNNNNNGG 1 cut(s) 19
BseMII CTCAG 1 cut(s) 177
BseNI ACTGG 2 cut(s) 13, 176
BseXI GCAGC 1 cut(s) 76
BslFI GGGAC 1 cut(s) 125
BslI CCNNNNNNNGG 1 cut(s) 19
BsmFI GGGAC 1 cut(s) 125
Bsp143I GATC 1 cut(s) 118
BspCNI CTCAG 1 cut(s) 178
BspPI GGATC 1 cut(s) 113
BsrI ACTGG 2 cut(s) 13, 176
BssMI GATC 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 186
BstF5I GGATG 2 cut(s) 112, 172
BstKTI GATC 1 cut(s) 121
BstMBI GATC 1 cut(s) 118
BstV1I GCAGC 1 cut(s) 76
BtsCI GGATG 2 cut(s) 112, 172
CviAII CATG 1 cut(s) 152
CviJI RGCY 2 cut(s) 67, 185
CviKI_1 RGCY 2 cut(s) 67, 185
DdeI CTNAG 1 cut(s) 186
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
EcoRI GAATTC 1 cut(s) 125
FaeI CATG 1 cut(s) 155
FaiI YATR 4 cut(s) 32, 117, 144, 153
FaqI GGGAC 1 cut(s) 125
FatI CATG 1 cut(s) 151
Fnu4HI GCNGC 1 cut(s) 65
FokI GGATG 2 cut(s) 119, 179
Fsp4HI GCNGC 1 cut(s) 65
GluI GCNGC 1 cut(s) 65
Hin1II CATG 1 cut(s) 155
Hpy188III TCNNGA 1 cut(s) 122
HpyF3I CTNAG 1 cut(s) 186
Hsp92II CATG 1 cut(s) 155
Kzo9I GATC 1 cut(s) 118
LpnPI CCDG 3 cut(s) 26, 135, 157
Lsp1109I GCAGC 1 cut(s) 76
MalI GATC 1 cut(s) 120
MboI GATC 1 cut(s) 118
MboII GAAGA 1 cut(s) 70
MluCI AATT 1 cut(s) 125
MnlI CCTC 3 cut(s) 71, 97, 157
MspA1I CMGCKG 1 cut(s) 67
NdeII GATC 1 cut(s) 118
NlaIII CATG 1 cut(s) 155
PkrI GCNGC 1 cut(s) 66
PvuII CAGCTG 1 cut(s) 67
SatI GCNGC 1 cut(s) 65
Sau3AI GATC 1 cut(s) 118
SetI ASST 3 cut(s) 69, 82, 187
SgeI CNNG 7 cut(s) 25, 32, 36, 111, 134, 164, 184
Sse9I AATT 1 cut(s) 125
TaqI TCGA 1 cut(s) 129
TasI AATT 1 cut(s) 125
TseI GCWGC 1 cut(s) 64
TspDTI ATGAA 4 cut(s) 71, 87, 105, 153
XapI RAATTY 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.