Rmu_sc0026676.1_g000001

F-box FBD LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026676.1
OG0000467
Physical Location & Seq
Reverse (-)
1123 .. 2343
1221 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026676.1_g000001.1.cds

Sequence Viewer

Length: 1221 bp
atgaaggaaactataatatactgtacccatgccgcaaaatttccttgccaagagttggggggggttccgaacaaatcttgtttgtctagggttgaggaacttgtactcgacatcaggttgagttctggaaacacatctgatttgcctcaatgtcaactcatgtgccactcattaaggagtagtagctgtgggaattcaaaggcatggctagggtttccctcgtcttatgttgtcgggtcttatctccgttcacttcatactttgtctctaactcgtgtggatttcttggatagtagtgctttgggtgtggatttttttgctggttcttcattcccttatctcgaaaagttgaacttagagcgctgtagagggaggagtgatctcaaaatttgctgtccaaacctaaaacatgtagaggtatttgatatggaattaaatagtctggacatctccggaatgagactggaggagttgcgagtctggttttgttttcaagagtatatcaatggaagttgggtcaacatttttgcaccgaatctgcaatcattcacttggggttattcaggcattactgaaaggtgttcgatccagagctttcctatgctcaaaagatctttcataaagtccccccttacaacgaagaagattaataataacagtgttgtcgatcttctttctgcttcatcccaagttgaagactttataatatccgatcactacctccagattctatcagaaatatattctgaattaggcggtctaccattctcatttatgaaactgaaaaccttgagaatcgggagtccaatgaagcaaagatatatccctggtatggcatgcctgttcaagagctctcccgtggtccacaacctcgagatttgtttttactcttacgaagaagatggcaagtggaacaaccaatccttggatgttgccaatcgcagccaagaacaatactgggagactcagggtcaatatttgagcccctctcttagtcacctaaaggtggtcagaattcgccttggtgaaatgatccccgagagtgcaatcaaatttgcaaagtttgtgctcaaatatggaagaaacctgcaaaaaatgagtgttagctttgatatgaacaaaagttgtctacctcccaattcgctgagtgataccattgctttaataaagagtttccgccgggcatctccatatatcaaattctcaactcattgctattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD

Protein Analysis

406

Amino Acids

46.16

Weight (kDa)

8.62

Isoelectric Point (pI)

56.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000467)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g02550 FvH4_6g26921 FvH4_6g45630
malus_domestica MD01G1113200.v1.1 MD09G1101600.v1.1 MD17G1084600.v1.1
prunus_persica Prupe.3G224400_v2.0.a1 Prupe.3G224500_v2.0.a1 Prupe.3G224600_v2.0.a1
pyrus_communis pycom02g19930 pycom09g00760 pycom09g00770 pycom17g08170
rosa_chinensis RchiOBHm_Chr1g0350511 RchiOBHm_Chr2g0086171 RchiOBHm_Chr2g0117831 RchiOBHm_Chr3g0450391 RchiOBHm_Chr4g0409631 RchiOBHm_Chr5g0039731
rosa_laevigata RLG00000008538 RLG00000018375 RLG00000021415 RLG00000028481 RLG00000033926 RLG00000033937 RLG00000033938 RLG00000033939 RLG00000033941
rosa_multiflora Rmu_sc0000103.1_g000011 Rmu_sc0000330.1_g000009 Rmu_sc0000652.1_g000002 Rmu_sc0001507.1_g000017 Rmu_sc0004020.1_g000010 Rmu_sc0026676.1_g000001 Rmu_ssc0000083.1_g000022 Rmu_ssc0000400.1_g000021
rosa_roxburghii Rroxscaffold_1G00040760 Rroxscaffold_1G00041490 Rroxscaffold_1G00041500 Rroxscaffold_1G00041630 Rroxscaffold_2G00087990 Rroxscaffold_2G00126200 Rroxscaffold_4G00304800 Rroxscaffold_5G00354160 Rroxscaffold_5G00354170
rosa_rugosa Rorug01G0211500 Rorug02G0214300 Rorug02G0496800 Rorug02G0627700 Rorug04G0095600 Rorug05G0181700
rosa_samantha Rh1AG226300 Rh1BG194700 Rh1CG211100 Rh1DG222900 Rh2AG270500 Rh2AG270600 Rh2AG562900 Rh2AG563000 Rh2BG281900 Rh2BG282000 Rh2BG575700 Rh2CG269300 Rh2CG269400 Rh2DG278300 Rh2DG296200 Rh2DG585900 Rh3AG028000 Rh3AG028100 Rh3BG028500 Rh3BG028600 Rh3CG027300 Rh3CG027400 Rh3DG028400 Rh3DG028500 Rh4BG156800 Rh4CG167300 Rh4CG167400 Rh4DG151100 Rh5AG268000 Rh5BG272400 Rh5BG272500 Rh5CG304000 Rh5CG305000 Rh5CG305100 Rh5DG280500
rosa_wichuraiana Rw1G019530 Rw2G021370 Rw4G012860 Rw4G012970 Rw5G025070

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 704
Acc36I ACCTGC 1 cut(s) 1095
AccB7I CCANNNNNTGG 2 cut(s) 55, 925
AccI GTMKAC 2 cut(s) 760, 1129
AccIII TCCGGA 1 cut(s) 452
AciI CCGC 3 cut(s) 33, 756, 1177
AclWI GGATC 2 cut(s) 580, 1027
AcsI RAATTY 6 cut(s) 38, 193, 387, 1014, 1052, 1199
AfaI GTAC 2 cut(s) 25, 105
AfeI AGCGCT 1 cut(s) 362
AfiI CCNNNNNNNGG 4 cut(s) 55, 832, 925, 1006
AflIII ACRYGT 1 cut(s) 409
AgsI TTSAA 5 cut(s) 198, 352, 494, 695, 847
AhdI GACNNNNNGTC 1 cut(s) 969
AjnI CCWGG 1 cut(s) 826
AloI GAACNNNNNNTCC 2 cut(s) 905, 937
AluBI AGCT 4 cut(s) 186, 594, 852, 1107
AluI AGCT 4 cut(s) 186, 594, 852, 1107
Alw21I GWGCWC 2 cut(s) 854, 1071
Alw26I GTCTC 3 cut(s) 270, 454, 956
AlwI GGATC 2 cut(s) 580, 1027
Ama87I CYCGRG 2 cut(s) 872, 1037
Aor13HI TCCGGA 1 cut(s) 452
Aor51HI AGCGCT 1 cut(s) 362
ApeKI GCWGC 1 cut(s) 942
ApoI RAATTY 6 cut(s) 38, 193, 387, 1014, 1052, 1199
AseI ATTAAT 1 cut(s) 648
AspLEI GCGC 1 cut(s) 363
AspS9I GGNCC 1 cut(s) 862
AsuC2I CCSGG 1 cut(s) 1181
AsuHPI GGTGA 2 cut(s) 989, 1037
AvaI CYCGRG 2 cut(s) 872, 1037
AvaII GGWCC 1 cut(s) 862
BanII GRGCYC 2 cut(s) 854, 986
BauI CACGAG 1 cut(s) 273
BbsI GAAGAC 1 cut(s) 702
Bbv12I GWGCWC 2 cut(s) 854, 1071
BbvI GCAGC 1 cut(s) 954
BccI CCATC 1 cut(s) 896
BciT130I CCWGG 1 cut(s) 828
BcnI CCSGG 1 cut(s) 1181
BcoDI GTCTC 3 cut(s) 270, 454, 956
BfaI CTAG 2 cut(s) 87, 209
BfmI CTRYAG 1 cut(s) 364
BfoI RGCGCY 1 cut(s) 364
BfuAI ACCTGC 1 cut(s) 1095
BglII AGATCT 1 cut(s) 611
BisI GCNGC 2 cut(s) 33, 943
BlsI GCNGC 2 cut(s) 34, 944
Bme1390I CCNGG 2 cut(s) 828, 1181
Bme18I GGWCC 1 cut(s) 862
BmeRI GACNNNNNGTC 1 cut(s) 969
BmeT110I CYCGRG 2 cut(s) 872, 1037
BmgT120I GGNCC 1 cut(s) 862
BmiI GGNNCC 1 cut(s) 66
BmrFI CCNGG 2 cut(s) 828, 1181
BmrI ACTGGG 1 cut(s) 967
BmsI GCATC 1 cut(s) 1193
BmuI ACTGGG 1 cut(s) 967
BpiI GAAGAC 1 cut(s) 702
BplI GAGNNNNNCTC 2 cut(s) 973, 1005
BpmI CTGGAG 2 cut(s) 485, 707
BpuEI CTTGAG 1 cut(s) 811
BpuMI CCSGG 1 cut(s) 1181
BsaJI CCNNGG 4 cut(s) 826, 858, 924, 1021
BsaWI WCCGGW 1 cut(s) 452
Bsc4I CCNNNNNNNGG 4 cut(s) 55, 832, 925, 1006
Bse1I ACTGG 2 cut(s) 468, 962
Bse3DI GCAATG 2 cut(s) 1155, 1210
BseAI TCCGGA 1 cut(s) 452
BseBI CCWGG 1 cut(s) 828
BseDI CCNNGG 4 cut(s) 826, 858, 924, 1021
BseGI GGATG 2 cut(s) 683, 934
BseLI CCNNNNNNNGG 4 cut(s) 55, 832, 925, 1006
BseMI GCAATG 2 cut(s) 1155, 1210
BseMII CTCAG 2 cut(s) 980, 1136
BseNI ACTGG 2 cut(s) 468, 962
BseRI GAGGAG 2 cut(s) 388, 482
BseXI GCAGC 1 cut(s) 954
BsiHKAI GWGCWC 2 cut(s) 854, 1071
BsiHKCI CYCGRG 2 cut(s) 872, 1037
BsiSI CCGG 2 cut(s) 453, 1180
BslFI GGGAC 1 cut(s) 610
BslI CCNNNNNNNGG 4 cut(s) 55, 832, 925, 1006
BsmAI GTCTC 3 cut(s) 270, 454, 956
BsmFI GGGAC 1 cut(s) 610
BsoBI CYCGRG 2 cut(s) 872, 1037
Bsp1286I GDGCHC 3 cut(s) 854, 986, 1071
Bsp13I TCCGGA 1 cut(s) 452
Bsp143I GATC 6 cut(s) 379, 585, 611, 667, 712, 1032
BspACI CCGC 3 cut(s) 33, 756, 1177
BspCNI CTCAG 2 cut(s) 979, 1137
BspEI TCCGGA 1 cut(s) 452
BspLI GGNNCC 1 cut(s) 66
BspMI ACCTGC 1 cut(s) 1095
BspPI GGATC 2 cut(s) 580, 1027
BsrDI GCAATG 2 cut(s) 1155, 1210
BsrI ACTGG 2 cut(s) 468, 962
BssECI CCNNGG 4 cut(s) 826, 858, 924, 1021
BssMI GATC 6 cut(s) 379, 585, 611, 667, 712, 1032
BssSI CACGAG 1 cut(s) 273
BssT1I CCWWGG 2 cut(s) 924, 1021
Bst2BI CACGAG 1 cut(s) 273
Bst2UI CCWGG 1 cut(s) 828
Bst4CI ACNGT 2 cut(s) 23, 659
BstC8I GCNNGC 1 cut(s) 838
BstDEI CTNAG 4 cut(s) 355, 966, 992, 1145
BstDSI CCRYGG 1 cut(s) 858
BstF5I GGATG 2 cut(s) 683, 934
BstH2I RGCGCY 1 cut(s) 364
BstHHI GCGC 1 cut(s) 363
BstKTI GATC 6 cut(s) 382, 588, 614, 670, 715, 1035
BstMAI GTCTC 3 cut(s) 270, 454, 956
BstMBI GATC 6 cut(s) 379, 585, 611, 667, 712, 1032
BstNI CCWGG 1 cut(s) 828
BstNSI RCATGY 2 cut(s) 413, 840
BstSCI CCNGG 2 cut(s) 826, 1179
BstSFI CTRYAG 1 cut(s) 364
BstV1I GCAGC 1 cut(s) 954
BstV2I GAAGAC 1 cut(s) 702
BstX2I RGATCY 1 cut(s) 611
BstYI RGATCY 1 cut(s) 611
BtgI CCRYGG 1 cut(s) 858
BtsCI GGATG 2 cut(s) 683, 934
BtsIMutI CAGTG 1 cut(s) 664
BveI ACCTGC 1 cut(s) 1095
Cac8I GCNNGC 1 cut(s) 838
CfoI GCGC 1 cut(s) 363
Cfr13I GGNCC 1 cut(s) 862
Csp6I GTAC 2 cut(s) 24, 104
CviAII CATG 5 cut(s) 29, 160, 204, 410, 837
CviJI RGCY 7 cut(s) 186, 208, 594, 852, 945, 984, 1107
CviKI_1 RGCY 7 cut(s) 186, 208, 594, 852, 945, 984, 1107
CviQI GTAC 2 cut(s) 24, 104
DdeI CTNAG 4 cut(s) 355, 966, 992, 1145
DpnI GATC 6 cut(s) 381, 587, 613, 669, 714, 1034
DpnII GATC 6 cut(s) 379, 585, 611, 667, 712, 1032
DriI GACNNNNNGTC 1 cut(s) 969
Eam1105I GACNNNNNGTC 1 cut(s) 969
EciI GGCGGA 1 cut(s) 1166
Ecl136II GAGCTC 1 cut(s) 852
Eco130I CCWWGG 2 cut(s) 924, 1021
Eco24I GRGCYC 2 cut(s) 854, 986
Eco47I GGWCC 1 cut(s) 862
Eco47III AGCGCT 1 cut(s) 362
Eco53kI GAGCTC 1 cut(s) 852
Eco88I CYCGRG 2 cut(s) 872, 1037
EcoICRI GAGCTC 1 cut(s) 852
EcoRI GAATTC 2 cut(s) 193, 1014
EcoRII CCWGG 1 cut(s) 826
EcoT14I CCWWGG 2 cut(s) 924, 1021
EcoT38I GRGCYC 2 cut(s) 854, 986
ErhI CCWWGG 2 cut(s) 924, 1021
FaeI CATG 5 cut(s) 32, 163, 207, 413, 840
FalI AAGNNNNNCTT 2 cut(s) 338, 370
FaqI GGGAC 1 cut(s) 610
FatI CATG 5 cut(s) 28, 159, 203, 409, 836
FblI GTMKAC 2 cut(s) 760, 1129
Fnu4HI GCNGC 2 cut(s) 33, 943
FokI GGATG 2 cut(s) 670, 941
FriOI GRGCYC 2 cut(s) 854, 986
Fsp4HI GCNGC 2 cut(s) 33, 943
FspBI CTAG 2 cut(s) 87, 209
GlaI GCGC 1 cut(s) 362
GluI GCNGC 2 cut(s) 33, 943
GsuI CTGGAG 2 cut(s) 485, 707
HaeII RGCGCY 1 cut(s) 364
HapII CCGG 2 cut(s) 453, 1180
HhaI GCGC 1 cut(s) 363
Hin1II CATG 5 cut(s) 32, 163, 207, 413, 840
Hin6I GCGC 1 cut(s) 361
HinP1I GCGC 1 cut(s) 361
HincII GTYRAC 2 cut(s) 155, 520
HindII GTYRAC 2 cut(s) 155, 520
HinfI GANTC 6 cut(s) 477, 535, 727, 795, 802, 964
HpaII CCGG 2 cut(s) 453, 1180
HphI GGTGA 2 cut(s) 989, 1037
Hpy166II GTNNAC 6 cut(s) 155, 251, 520, 761, 865, 1130
Hpy188I TCNGA 6 cut(s) 69, 139, 712, 736, 748, 1013
Hpy8I GTNNAC 6 cut(s) 155, 251, 520, 761, 865, 1130
HpyCH4III ACNGT 2 cut(s) 23, 659
HpyCH4V TGCA 5 cut(s) 530, 541, 1046, 1058, 1090
HpyF3I CTNAG 4 cut(s) 355, 966, 992, 1145
Hsp92II CATG 5 cut(s) 32, 163, 207, 413, 840
HspAI GCGC 1 cut(s) 361
Kpn2I TCCGGA 1 cut(s) 452
Kzo9I GATC 6 cut(s) 379, 585, 611, 667, 712, 1032
Lsp1109I GCAGC 1 cut(s) 954
LweI GCATC 1 cut(s) 1193
MaeI CTAG 2 cut(s) 87, 209
MaeIII GTNAC 1 cut(s) 995
MalI GATC 6 cut(s) 381, 587, 613, 669, 714, 1034
MboI GATC 6 cut(s) 379, 585, 611, 667, 712, 1032
MboII GAAGA 8 cut(s) 318, 652, 655, 662, 707, 908, 911, 1092
MflI RGATCY 1 cut(s) 611
MhlI GDGCHC 3 cut(s) 854, 986, 1071
MluCI AATT 9 cut(s) 38, 193, 387, 431, 749, 1014, 1052, 1138, 1199
MlyI GAGTC 3 cut(s) 486, 811, 958
MroI TCCGGA 1 cut(s) 452
MseI TTAA 4 cut(s) 173, 434, 648, 1163
MspI CCGG 2 cut(s) 453, 1180
MspR9I CCNGG 2 cut(s) 828, 1181
MvaI CCWGG 1 cut(s) 828
NciI CCSGG 1 cut(s) 1181
NdeII GATC 6 cut(s) 379, 585, 611, 667, 712, 1032
NlaIII CATG 5 cut(s) 32, 163, 207, 413, 840
NlaIV GGNNCC 1 cut(s) 66
NmuCI GTSAC 1 cut(s) 995
NspI RCATGY 2 cut(s) 413, 840
PaeI GCATGC 1 cut(s) 840
PaeR7I CTCGAG 1 cut(s) 872
PciI ACATGT 1 cut(s) 409
PfeI GAWTC 3 cut(s) 535, 727, 795
PflMI CCANNNNNTGG 2 cut(s) 55, 925
PkrI GCNGC 2 cut(s) 34, 944
PleI GAGTC 3 cut(s) 485, 810, 958
PpsI GAGTC 3 cut(s) 485, 810, 958
PscI ACATGT 1 cut(s) 409
PshBI ATTAAT 1 cut(s) 648
PsiI TTATAA 1 cut(s) 704
Psp124BI GAGCTC 1 cut(s) 854
Psp6I CCWGG 1 cut(s) 826
PspGI CCWGG 1 cut(s) 826
PspN4I GGNNCC 1 cut(s) 66
PspPI GGNCC 1 cut(s) 862
PsuI RGATCY 1 cut(s) 611
RsaI GTAC 2 cut(s) 25, 105
RsaNI GTAC 2 cut(s) 24, 104
SacI GAGCTC 1 cut(s) 854
SaqAI TTAA 4 cut(s) 173, 434, 648, 1163
SatI GCNGC 2 cut(s) 33, 943
Sau3AI GATC 6 cut(s) 379, 585, 611, 667, 712, 1032
Sau96I GGNCC 1 cut(s) 862
SchI GAGTC 3 cut(s) 486, 811, 958
ScrFI CCNGG 2 cut(s) 828, 1181
SduI GDGCHC 3 cut(s) 854, 986, 1071
SfaNI GCATC 1 cut(s) 1193
SfcI CTRYAG 1 cut(s) 364
Sfr274I CTCGAG 1 cut(s) 872
SinI GGWCC 1 cut(s) 862
SlaI CTCGAG 1 cut(s) 872
SmlI CTYRAG 2 cut(s) 790, 872
SmoI CTYRAG 2 cut(s) 790, 872
SphI GCATGC 1 cut(s) 840
Sse9I AATT 9 cut(s) 38, 193, 387, 431, 749, 1014, 1052, 1138, 1199
SsiI CCGC 3 cut(s) 33, 756, 1177
SspI AATATT 1 cut(s) 977
SspMI CTAG 2 cut(s) 87, 209
SstI GAGCTC 1 cut(s) 854
StyD4I CCNGG 2 cut(s) 826, 1179
StyI CCWWGG 2 cut(s) 924, 1021
TaaI ACNGT 2 cut(s) 23, 659
TaqI TCGA 5 cut(s) 108, 342, 584, 666, 873
TasI AATT 9 cut(s) 38, 193, 387, 431, 749, 1014, 1052, 1138, 1199
TatI WGTACW 1 cut(s) 103
TauI GCSGC 1 cut(s) 35
TfiI GAWTC 3 cut(s) 535, 727, 795
Tru1I TTAA 4 cut(s) 173, 434, 648, 1163
Tru9I TTAA 4 cut(s) 173, 434, 648, 1163
TscAI CASTG 1 cut(s) 664
TseFI GTSAC 1 cut(s) 995
TseI GCWGC 1 cut(s) 942
Tsp45I GTSAC 1 cut(s) 995
TspDTI ATGAA 8 cut(s) 17, 245, 318, 607, 672, 791, 824, 1130
TspGWI ACGGA 1 cut(s) 236
TspRI CASTG 1 cut(s) 664
Van91I CCANNNNNTGG 2 cut(s) 55, 925
VpaK11BI GGWCC 1 cut(s) 862
VspI ATTAAT 1 cut(s) 648
XapI RAATTY 6 cut(s) 38, 193, 387, 1014, 1052, 1199
XceI RCATGY 2 cut(s) 413, 840
XhoI CTCGAG 1 cut(s) 872
XmiI GTMKAC 2 cut(s) 760, 1129
XspI CTAG 2 cut(s) 87, 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.