Rh7BG475300

SpoU rRNA Methylase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0000343
Physical Location & Seq
Reverse (-)
56003289 .. 56007079
3791 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG475300.1

Sequence Viewer

Length: 207 bp
ATGGCATCTTTTGATAATGAGGCAGAGCCTCTGCCAGTTACGAATTACTATTTCAAAGATGACAAGAATGAACCTATTTCGTTTCATGTTTATAAACTAGATATCAATGCTGATGAAAAGGAGGCAAGCTGTGGGGCTTGGTTCCCATCCCCACATCGAGTTTTGGTGCTTGATGGTGTTCAGCTAAAGATTTTGTTCAAAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SpoU_methylase

Protein Analysis

68

Amino Acids

7.77

Weight (kDa)

4.88

Isoelectric Point (pI)

29.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000343)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G48090 AT5G48090 AT5G48090 AT5G55390 AT5G55390 AT5G55390
fragaria_vesca FvH4_3g23690 FvH4_4g08730 FvH4_4g08730 FvH4_4g08730 FvH4_4g08730 FvH4_4g08730 FvH4_4g08730 FvH4_5g31160 FvH4_5g31160 FvH4_5g31160 FvH4_5g31160 FvH4_5g31160
malus_domestica MD03G1191000.v1.1 MD11G1207800.v1.1 MD11G1208000.v1.1
prunus_persica Prupe.4G227500_v2.0.a1 Prupe.4G227500_v2.0.a1 Prupe.4G227500_v2.0.a1 Prupe.4G227500_v2.0.a1 Prupe.4G227500_v2.0.a1 Prupe.4G227500_v2.0.a1 Prupe.4G227600_v2.0.a1 Prupe.4G227700_v2.0.a1 Prupe.4G227800_v2.0.a1 Prupe.4G227800_v2.0.a1 Prupe.4G227800_v2.0.a1 Prupe.4G227800_v2.0.a1 Prupe.4G227800_v2.0.a1
pyrus_communis pycom01g03400 pycom03g14420 pycom11g18100 pycom11g18140 pycom11g18150 pycom11g18160
rosa_chinensis RchiOBHm_Chr2g0145981 RchiOBHm_Chr4g0405241 RchiOBHm_Chr4g0405271 RchiOBHm_Chr5g0016201 RchiOBHm_Chr5g0041831 RchiOBHm_Chr5g0041871 RchiOBHm_Chr5g0041881 RchiOBHm_Chr5g0059241
rosa_laevigata RLG00000002117 RLG00000008861 RLG00000008862 RLG00000011000 RLG00000033216 RLG00000034097 RLG00000034101
rosa_multiflora Rmu_sc0000161.1_g000001 Rmu_sc0000861.1_g000040 Rmu_sc0007522.1_g000003 Rmu_sc0009443.1_g000015 Rmu_sc0022129.1_g000001 Rmu_sc0042315.1_g000001
rosa_roxburghii Rroxscaffold_1G00038660 Rroxscaffold_1G00038690 Rroxscaffold_5G00349560 Rroxscaffold_5G00349610 Rroxscaffold_6G00388370 Rroxscaffold_7G00188740
rosa_rugosa Rorug03G0199700 Rorug04G0055400 Rorug04G0055500 Rorug04G0055900 Rorug04G0056000 Rorug04G0056100 Rorug04G0056100 Rorug04G0056200 Rorug05G0195600 Rorug05G0195700 Rorug05G0195800 Rorug05G0195900 Rorug05G0196800 Rorug05G0385000
rosa_samantha Rh4AG129900 Rh4AG130100 Rh4BG124200 Rh4BG124400 Rh4BG124500 Rh4CG137200 Rh4CG137300 Rh4DG123500 Rh4DG123700 Rh5AG280800 Rh5AG281400 Rh5BG286700 Rh5BG287000 Rh5BG397800 Rh5CG318100 Rh5CG318600 Rh5CG421600 Rh5DG132300 Rh5DG132400 Rh5DG295400 Rh5DG295700 Rh7BG475300
rosa_wichuraiana Rw0G001330 Rw0G005730 Rw4G008670 Rw4G010510 Rw4G010540 Rw5G026450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 93
AgsI TTSAA 2 cut(s) 55, 199
AluBI AGCT 3 cut(s) 129, 184, 203
AluI AGCT 3 cut(s) 129, 184, 203
BccI CCATC 2 cut(s) 154, 167
BfaI CTAG 1 cut(s) 98
BmiI GGNNCC 1 cut(s) 143
BmsI GCATC 1 cut(s) 14
Bse1I ACTGG 1 cut(s) 35
BseGI GGATG 1 cut(s) 146
BseNI ACTGG 1 cut(s) 35
BspLI GGNNCC 1 cut(s) 143
BsrI ACTGG 1 cut(s) 35
BstC8I GCNNGC 1 cut(s) 127
BstF5I GGATG 1 cut(s) 146
BtsCI GGATG 1 cut(s) 146
Cac8I GCNNGC 1 cut(s) 127
CviAII CATG 1 cut(s) 86
CviJI RGCY 5 cut(s) 28, 129, 137, 184, 203
CviKI_1 RGCY 5 cut(s) 28, 129, 137, 184, 203
Eco32I GATATC 1 cut(s) 103
EcoRV GATATC 1 cut(s) 103
FaeI CATG 1 cut(s) 89
FaiI YATR 2 cut(s) 87, 93
FatI CATG 1 cut(s) 85
FokI GGATG 1 cut(s) 133
FspBI CTAG 1 cut(s) 98
Hin1II CATG 1 cut(s) 89
HindIII AAGCTT 1 cut(s) 201
Hsp92II CATG 1 cut(s) 89
LpnPI CCDG 1 cut(s) 48
LweI GCATC 1 cut(s) 14
MaeI CTAG 1 cut(s) 98
MaeIII GTNAC 1 cut(s) 37
MluCI AATT 1 cut(s) 43
MnlI CCTC 3 cut(s) 13, 39, 115
NlaIII CATG 1 cut(s) 89
NlaIV GGNNCC 1 cut(s) 143
PsiI TTATAA 1 cut(s) 93
PspN4I GGNNCC 1 cut(s) 143
SetI ASST 4 cut(s) 76, 131, 186, 205
SfaNI GCATC 1 cut(s) 14
SgeI CNNG 8 cut(s) 47, 76, 98, 110, 138, 150, 170, 182
Sse9I AATT 1 cut(s) 43
SspMI CTAG 1 cut(s) 98
TaqI TCGA 1 cut(s) 157
TasI AATT 1 cut(s) 43
TspDTI ATGAA 3 cut(s) 74, 84, 129
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.