FvH4_1g04920

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
OG0000544
Physical Location & Seq
Forward (+)
2615646 .. 2616613
968 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g04920.t1

Sequence Viewer

Length: 237 bp
ATGGAGGACTTTGTTGCCAAACTTTCTGATCCCAAACTGTCGCTCCTCAACTTCCAGAACCTCTACTTCCATCAGTTCTTGCAGAGCAGGGAGCAGATAACTGCCTTTCCTGGGCAGCTCACTTCAATCAATGCAAGAGCAAAAGATGTTCCTACTCCTCTAGATACCTTCGACAAGGTTCAGATTGGAGAGCGACTAAGCAGCAGTTACATCGTTTCGGAGTGGACAAGTATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.92

Weight (kDa)

5.12

Isoelectric Point (pI)

26.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 23
AfiI CCNNNNNNNGG 1 cut(s) 111
AgsI TTSAA 1 cut(s) 126
AjnI CCWGG 1 cut(s) 109
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
AlwI GGATC 1 cut(s) 23
ApeKI GCWGC 2 cut(s) 115, 201
BbvI GCAGC 2 cut(s) 127, 213
BccI CCATC 1 cut(s) 78
BcgI CGANNNNNNTGC 2 cut(s) 193, 227
BciT130I CCWGG 1 cut(s) 111
BfaI CTAG 1 cut(s) 161
BisI GCNGC 2 cut(s) 116, 202
BlsI GCNGC 2 cut(s) 117, 203
Bme1390I CCNGG 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 110
BsaXI ACNNNNNCTCC 2 cut(s) 27, 57
Bsc4I CCNNNNNNNGG 1 cut(s) 111
BseBI CCWGG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 110
BseLI CCNNNNNNNGG 1 cut(s) 111
BseRI GAGGAG 2 cut(s) 35, 147
BseXI GCAGC 2 cut(s) 127, 213
BslI CCNNNNNNNGG 1 cut(s) 111
Bsp143I GATC 1 cut(s) 28
BspPI GGATC 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 110
BssMI GATC 1 cut(s) 28
Bst2UI CCWGG 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 39
BstDEI CTNAG 1 cut(s) 197
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
BstNI CCWGG 1 cut(s) 111
BstSCI CCNGG 1 cut(s) 109
BstV1I GCAGC 2 cut(s) 127, 213
CviJI RGCY 1 cut(s) 118
CviKI_1 RGCY 1 cut(s) 118
DdeI CTNAG 1 cut(s) 197
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 109
Fnu4HI GCNGC 2 cut(s) 116, 202
Fsp4HI GCNGC 2 cut(s) 116, 202
FspBI CTAG 1 cut(s) 161
GluI GCNGC 2 cut(s) 116, 202
Hpy166II GTNNAC 1 cut(s) 225
Hpy188I TCNGA 3 cut(s) 28, 183, 220
Hpy188III TCNNGA 2 cut(s) 55, 161
Hpy8I GTNNAC 1 cut(s) 225
HpyAV CCTTC 1 cut(s) 178
HpyCH4III ACNGT 1 cut(s) 39
HpyCH4V TGCA 2 cut(s) 82, 134
HpyF3I CTNAG 1 cut(s) 197
Kzo9I GATC 1 cut(s) 28
LmnI GCTCC 2 cut(s) 48, 91
LpnPI CCDG 4 cut(s) 68, 73, 96, 123
Lsp1109I GCAGC 2 cut(s) 127, 213
MaeI CTAG 1 cut(s) 161
MaeIII GTNAC 1 cut(s) 206
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MnlI CCTC 3 cut(s) 56, 71, 168
MspR9I CCNGG 1 cut(s) 111
MvaI CCWGG 1 cut(s) 111
NdeII GATC 1 cut(s) 28
PkrI GCNGC 2 cut(s) 117, 203
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
SatI GCNGC 2 cut(s) 116, 202
Sau3AI GATC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 111
SetI ASST 4 cut(s) 63, 120, 170, 180
SgeI CNNG 8 cut(s) 67, 91, 100, 122, 123, 147, 173, 187
SspMI CTAG 1 cut(s) 161
StyD4I CCNGG 1 cut(s) 109
TaaI ACNGT 1 cut(s) 39
TaqI TCGA 1 cut(s) 171
TseI GCWGC 2 cut(s) 115, 201
XbaI TCTAGA 1 cut(s) 160
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.