Rh2DG061700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0000544
Physical Location & Seq
Reverse (-)
4532129 .. 4532329
201 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG061700.1

Sequence Viewer

Length: 201 bp
ATGACAAATGGCAAGTGGAAGCCCAGTAAAGCTACCGGTCCCGTGGCGGTGGCAAAGCGTCAGAGGTTGCCGAATCGTTCGATGGTGGATGCGTACCTCCGATACTGTGGAGGGGTCGTCAAACGTAGAGTCTTCAGCTTCTTCAATAAGAAGAAAGTCTTGGACTGGATTCCTGAGGAAATCTTTCAACATCCAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.68

Weight (kDa)

10.55

Isoelectric Point (pI)

53.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 47
AcuI CTGAAG 1 cut(s) 118
AfaI GTAC 1 cut(s) 95
AgeI ACCGGT 1 cut(s) 35
AgsI TTSAA 2 cut(s) 145, 188
AjuI GAANNNNNNNTTGG 2 cut(s) 143, 175
AluBI AGCT 2 cut(s) 32, 138
AluI AGCT 2 cut(s) 32, 138
ArsI GACNNNNNNTTYG 2 cut(s) 114, 146
AsiGI ACCGGT 1 cut(s) 35
Asp700I GAANNNNTTC 1 cut(s) 183
AspS9I GGNCC 1 cut(s) 38
AvaII GGWCC 1 cut(s) 38
AxyI CCTNAGG 1 cut(s) 174
BbsI GAAGAC 1 cut(s) 124
BccI CCATC 1 cut(s) 76
Bme18I GGWCC 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 38
BmiI GGNNCC 1 cut(s) 40
BmrI ACTGGG 1 cut(s) 18
BmsI GCATC 1 cut(s) 79
BmuI ACTGGG 1 cut(s) 18
BpiI GAAGAC 1 cut(s) 124
BsaJI CCNNGG 1 cut(s) 42
BsaWI WCCGGW 1 cut(s) 35
BsaXI ACNNNNNCTCC 2 cut(s) 102, 132
Bse118I RCCGGY 1 cut(s) 35
Bse1I ACTGG 3 cut(s) 24, 170, 194
Bse21I CCTNAGG 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 42
BseGI GGATG 2 cut(s) 94, 190
BseMII CTCAG 1 cut(s) 165
BseNI ACTGG 3 cut(s) 24, 170, 194
BshTI ACCGGT 1 cut(s) 35
BsiSI CCGG 1 cut(s) 36
BslFI GGGAC 1 cut(s) 24
BsmFI GGGAC 1 cut(s) 24
BspACI CCGC 1 cut(s) 47
BspCNI CTCAG 1 cut(s) 166
BspLI GGNNCC 1 cut(s) 40
BsrFI RCCGGY 1 cut(s) 35
BsrI ACTGG 3 cut(s) 24, 170, 194
BssAI RCCGGY 1 cut(s) 35
BssECI CCNNGG 1 cut(s) 42
Bst4CI ACNGT 1 cut(s) 107
BstDEI CTNAG 1 cut(s) 174
BstDSI CCRYGG 1 cut(s) 42
BstF5I GGATG 2 cut(s) 94, 190
BstV2I GAAGAC 1 cut(s) 124
Bsu36I CCTNAGG 1 cut(s) 174
BtgI CCRYGG 1 cut(s) 42
BtsCI GGATG 2 cut(s) 94, 190
Cfr10I RCCGGY 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 38
CseI GACGC 1 cut(s) 47
Csp6I GTAC 1 cut(s) 94
CspAI ACCGGT 1 cut(s) 35
CviJI RGCY 3 cut(s) 22, 32, 138
CviKI_1 RGCY 3 cut(s) 22, 32, 138
CviQI GTAC 1 cut(s) 94
DdeI CTNAG 1 cut(s) 174
Eco47I GGWCC 1 cut(s) 38
Eco57I CTGAAG 1 cut(s) 118
Eco81I CCTNAGG 1 cut(s) 174
FalI AAGNNNNNCTT 2 cut(s) 143, 175
FaqI GGGAC 1 cut(s) 24
FokI GGATG 2 cut(s) 101, 177
HapII CCGG 1 cut(s) 36
HgaI GACGC 1 cut(s) 47
HinfI GANTC 3 cut(s) 73, 129, 169
HpaII CCGG 1 cut(s) 36
Hpy188I TCNGA 2 cut(s) 63, 101
Hpy188III TCNNGA 1 cut(s) 173
HpyCH4III ACNGT 1 cut(s) 107
HpyCH4IV ACGT 1 cut(s) 124
HpyF3I CTNAG 1 cut(s) 174
HpySE526I ACGT 1 cut(s) 124
LpnPI CCDG 4 cut(s) 37, 49, 151, 186
LweI GCATC 1 cut(s) 79
MaeII ACGT 1 cut(s) 124
MboII GAAGA 3 cut(s) 124, 133, 163
MlyI GAGTC 1 cut(s) 138
MnlI CCTC 4 cut(s) 57, 104, 107, 169
MroXI GAANNNNTTC 1 cut(s) 183
MseI TTAA 1 cut(s) 199
MspI CCGG 1 cut(s) 36
NlaIV GGNNCC 1 cut(s) 40
PdmI GAANNNNTTC 1 cut(s) 183
PfeI GAWTC 2 cut(s) 73, 169
PinAI ACCGGT 1 cut(s) 35
PleI GAGTC 1 cut(s) 137
PpsI GAGTC 1 cut(s) 137
PspN4I GGNNCC 1 cut(s) 40
PspPI GGNCC 1 cut(s) 38
RsaI GTAC 1 cut(s) 95
RsaNI GTAC 1 cut(s) 94
SaqAI TTAA 1 cut(s) 199
Sau96I GGNCC 1 cut(s) 38
SchI GAGTC 1 cut(s) 138
SetI ASST 5 cut(s) 34, 68, 99, 127, 140
SfaNI GCATC 1 cut(s) 79
SgeI CNNG 8 cut(s) 25, 36, 48, 53, 55, 172, 178, 185
SinI GGWCC 1 cut(s) 38
SsiI CCGC 1 cut(s) 47
TaaI ACNGT 1 cut(s) 107
TaiI ACGT 1 cut(s) 127
TaqI TCGA 1 cut(s) 80
TfiI GAWTC 2 cut(s) 73, 169
Tru1I TTAA 1 cut(s) 199
Tru9I TTAA 1 cut(s) 199
VpaK11BI GGWCC 1 cut(s) 38
XmnI GAANNNNTTC 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.