Rh2DG050500

The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
3598721 .. 3600923
2203 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG050500.1

Sequence Viewer

Length: 375 bp
ATGGATAGTAGTGGGAAACTAAACTGGGCCAAGCATAATGAAATCCAAACTGTGAATATCAAAAGTGTGGGATCACATTTTGAGATTACAGATGGAGAAAGATTACCGTTGGCCGTGAAGGAGTTAGGAAACTGTGATCTTTATCCTCAAGCATCTATGTTTGATGAATCTTTAATCCAGTTGATAATGATGCCACTATTGTTTAGACGAATTGATGTGAATGTTAAGAGGGATGTAGTCTCTTCTTATTTGGACAGTGGAAGGGCAGTCGACGAACTAGGTGTTGAGGATGTTTTTGAGCTCCTTTTGGAGAGAAATGAGCGTGTCCAAACTGGATTATGGGTTGGCGACTGTTTTGTTTGTATTAGGAAGTAG

Protein Analysis

124

Amino Acids

14.12

Weight (kDa)

4.87

Isoelectric Point (pI)

37.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 270
AclWI GGATC 1 cut(s) 79
AcoI YGGCCR 1 cut(s) 111
AluBI AGCT 1 cut(s) 301
AluI AGCT 1 cut(s) 301
Alw21I GWGCWC 1 cut(s) 303
Alw26I GTCTC 1 cut(s) 244
AlwI GGATC 1 cut(s) 79
AoxI GGCC 2 cut(s) 27, 111
AspS9I GGNCC 1 cut(s) 27
BanII GRGCYC 1 cut(s) 303
Bbv12I GWGCWC 1 cut(s) 303
BccI CCATC 1 cut(s) 86
BceAI ACGGC 1 cut(s) 98
BcoDI GTCTC 1 cut(s) 244
BfaI CTAG 1 cut(s) 278
BmgT120I GGNCC 1 cut(s) 27
BmrI ACTGGG 1 cut(s) 34
BmsI GCATC 2 cut(s) 161, 180
BmuI ACTGGG 1 cut(s) 34
BpuEI CTTGAG 1 cut(s) 132
BsaBI GATNNNNATC 1 cut(s) 141
Bse1I ACTGG 3 cut(s) 29, 178, 337
Bse8I GATNNNNATC 1 cut(s) 141
BseGI GGATG 2 cut(s) 238, 295
BseJI GATNNNNATC 1 cut(s) 141
BseNI ACTGG 3 cut(s) 29, 178, 337
BshFI GGCC 2 cut(s) 29, 113
BsiHKAI GWGCWC 1 cut(s) 303
BsmAI GTCTC 1 cut(s) 244
BsnI GGCC 2 cut(s) 29, 113
Bsp1286I GDGCHC 1 cut(s) 303
Bsp143I GATC 2 cut(s) 71, 136
BspANI GGCC 2 cut(s) 29, 113
BspPI GGATC 1 cut(s) 79
BsrI ACTGG 3 cut(s) 29, 178, 337
BssMI GATC 2 cut(s) 71, 136
Bst4CI ACNGT 5 cut(s) 52, 108, 134, 257, 353
Bst6I CTCTTC 1 cut(s) 247
BstF5I GGATG 2 cut(s) 238, 295
BstKTI GATC 2 cut(s) 74, 139
BstMAI GTCTC 1 cut(s) 244
BstMBI GATC 2 cut(s) 71, 136
BsuRI GGCC 2 cut(s) 29, 113
BtsCI GGATG 2 cut(s) 238, 295
BtsIMutI CAGTG 1 cut(s) 262
Cfr13I GGNCC 1 cut(s) 27
CviJI RGCY 3 cut(s) 29, 113, 301
CviKI_1 RGCY 3 cut(s) 29, 113, 301
DpnI GATC 2 cut(s) 73, 138
DpnII GATC 2 cut(s) 71, 136
EaeI YGGCCR 1 cut(s) 111
Eam1104I CTCTTC 1 cut(s) 247
EarI CTCTTC 1 cut(s) 247
Ecl136II GAGCTC 1 cut(s) 301
Eco24I GRGCYC 1 cut(s) 303
Eco53kI GAGCTC 1 cut(s) 301
EcoICRI GAGCTC 1 cut(s) 301
EcoT38I GRGCYC 1 cut(s) 303
FaiI YATR 3 cut(s) 36, 158, 340
FblI GTMKAC 1 cut(s) 270
FokI GGATG 2 cut(s) 245, 302
FriOI GRGCYC 1 cut(s) 303
FspBI CTAG 1 cut(s) 278
HaeIII GGCC 2 cut(s) 29, 113
HincII GTYRAC 1 cut(s) 271
HindII GTYRAC 1 cut(s) 271
HinfI GANTC 1 cut(s) 167
Hpy166II GTNNAC 1 cut(s) 271
Hpy8I GTNNAC 1 cut(s) 271
Hpy99I CGWCG 1 cut(s) 275
HpyAV CCTTC 2 cut(s) 112, 255
HpyCH4III ACNGT 5 cut(s) 52, 108, 134, 257, 353
Kzo9I GATC 2 cut(s) 71, 136
LmnI GCTCC 1 cut(s) 306
LpnPI CCDG 3 cut(s) 10, 191, 318
LweI GCATC 2 cut(s) 161, 180
MaeI CTAG 1 cut(s) 278
MalI GATC 2 cut(s) 73, 138
MboI GATC 2 cut(s) 71, 136
MboII GAAGA 1 cut(s) 234
MhlI GDGCHC 1 cut(s) 303
MluCI AATT 1 cut(s) 210
MnlI CCTC 3 cut(s) 156, 222, 280
MseI TTAA 2 cut(s) 173, 225
NdeII GATC 2 cut(s) 71, 136
PfeI GAWTC 1 cut(s) 167
Psp124BI GAGCTC 1 cut(s) 303
PspPI GGNCC 1 cut(s) 27
SacI GAGCTC 1 cut(s) 303
SalI GTCGAC 1 cut(s) 269
SaqAI TTAA 2 cut(s) 173, 225
Sau3AI GATC 2 cut(s) 71, 136
Sau96I GGNCC 1 cut(s) 27
SduI GDGCHC 1 cut(s) 303
SetI ASST 2 cut(s) 283, 303
SfaNI GCATC 2 cut(s) 161, 180
SgeI CNNG 8 cut(s) 37, 43, 127, 161, 190, 290, 335, 345
SmlI CTYRAG 1 cut(s) 147
SmoI CTYRAG 1 cut(s) 147
Sse9I AATT 1 cut(s) 210
SspMI CTAG 1 cut(s) 278
SstI GAGCTC 1 cut(s) 303
TaaI ACNGT 5 cut(s) 52, 108, 134, 257, 353
TaqI TCGA 1 cut(s) 270
TasI AATT 1 cut(s) 210
TfiI GAWTC 1 cut(s) 167
Tru1I TTAA 2 cut(s) 173, 225
Tru9I TTAA 2 cut(s) 173, 225
TscAI CASTG 1 cut(s) 262
TspDTI ATGAA 2 cut(s) 54, 180
TspRI CASTG 1 cut(s) 262
XmiI GTMKAC 1 cut(s) 270
XspI CTAG 1 cut(s) 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.