Rh5CG152600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0000544
Physical Location & Seq
Forward (+)
14143747 .. 14144031
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG152600.1

Sequence Viewer

Length: 285 bp
ATGGCAGTGTGGAATTTGCGGAACATTAAATTCGACCATGAAGGCTTCAAAGAAAACTGGACTGATGCTTATACCCGATGGGATGCTTGGCGTTCGAGGAGTGACATAGACTTGTTTTGGACCTGCTGGGAGGATGATTACTTCTGGAGAGCTTATTGCTTCAGGCATTATGAGGATGAAGCAGAGCTGGTTAGAAATGGCATTACGCACTTTAACGAAAATGTAATGAAAGACATGCCCCCTCCTGATGATTTCTTCAACAAACGCCAAAAGATTTATGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

11.81

Weight (kDa)

5.07

Isoelectric Point (pI)

58.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 131
AciI CCGC 1 cut(s) 19
AcsI RAATTY 2 cut(s) 13, 29
AcuI CTGAAG 1 cut(s) 145
AgsI TTSAA 2 cut(s) 49, 259
AluBI AGCT 2 cut(s) 152, 187
AluI AGCT 2 cut(s) 152, 187
ApoI RAATTY 2 cut(s) 13, 29
AspS9I GGNCC 1 cut(s) 120
AvaII GGWCC 1 cut(s) 120
BccI CCATC 1 cut(s) 72
BfuAI ACCTGC 1 cut(s) 131
Bme18I GGWCC 1 cut(s) 120
BmgT120I GGNCC 1 cut(s) 120
BmsI GCATC 2 cut(s) 55, 73
BpmI CTGGAG 1 cut(s) 166
Bse1I ACTGG 1 cut(s) 62
BseGI GGATG 3 cut(s) 88, 139, 181
BseNI ACTGG 1 cut(s) 62
BseRI GAGGAG 1 cut(s) 112
BseYI CCCAGC 1 cut(s) 126
BspACI CCGC 1 cut(s) 19
BspMI ACCTGC 1 cut(s) 131
BsrI ACTGG 1 cut(s) 62
BstF5I GGATG 3 cut(s) 88, 139, 181
BstNSI RCATGY 1 cut(s) 238
BtsCI GGATG 3 cut(s) 88, 139, 181
BtsI GCAGTG 1 cut(s) 12
BtsIMutI CAGTG 1 cut(s) 12
BveI ACCTGC 1 cut(s) 131
Cfr13I GGNCC 1 cut(s) 120
CviAII CATG 3 cut(s) 38, 235, 282
CviJI RGCY 3 cut(s) 45, 152, 187
CviKI_1 RGCY 3 cut(s) 45, 152, 187
Eco47I GGWCC 1 cut(s) 120
Eco57I CTGAAG 1 cut(s) 145
EcoT22I ATGCAT 1 cut(s) 283
FaeI CATG 3 cut(s) 41, 238, 285
FaiI YATR 7 cut(s) 39, 72, 107, 171, 236, 279, 283
FatI CATG 3 cut(s) 37, 234, 281
FokI GGATG 3 cut(s) 95, 146, 188
GsaI CCCAGC 1 cut(s) 130
GsuI CTGGAG 1 cut(s) 166
Hin1II CATG 3 cut(s) 41, 238, 285
Hpy188III TCNNGA 2 cut(s) 145, 245
HpyAV CCTTC 1 cut(s) 35
HpyCH4V TGCA 1 cut(s) 281
Hsp92II CATG 3 cut(s) 41, 238, 285
LpnPI CCDG 7 cut(s) 43, 112, 130, 136, 148, 173, 258
LweI GCATC 2 cut(s) 55, 73
MaeIII GTNAC 1 cut(s) 101
MboII GAAGA 1 cut(s) 247
MluCI AATT 2 cut(s) 13, 29
MnlI CCTC 4 cut(s) 90, 124, 166, 252
Mph1103I ATGCAT 1 cut(s) 283
MseI TTAA 2 cut(s) 27, 213
NlaIII CATG 3 cut(s) 41, 238, 285
NmuCI GTSAC 1 cut(s) 101
NsiI ATGCAT 1 cut(s) 283
NspI RCATGY 1 cut(s) 238
PspFI CCCAGC 1 cut(s) 126
PspPI GGNCC 1 cut(s) 120
SaqAI TTAA 2 cut(s) 27, 213
Sau96I GGNCC 1 cut(s) 120
SetI ASST 3 cut(s) 125, 154, 189
SfaNI GCATC 2 cut(s) 55, 73
SinI GGWCC 1 cut(s) 120
Sse9I AATT 2 cut(s) 13, 29
SsiI CCGC 1 cut(s) 19
TaqI TCGA 2 cut(s) 33, 95
TasI AATT 2 cut(s) 13, 29
Tru1I TTAA 2 cut(s) 27, 213
Tru9I TTAA 2 cut(s) 27, 213
TscAI CASTG 1 cut(s) 12
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
TspDTI ATGAA 3 cut(s) 54, 192, 242
TspRI CASTG 1 cut(s) 12
VpaK11BI GGWCC 1 cut(s) 120
XapI RAATTY 2 cut(s) 13, 29
XceI RCATGY 1 cut(s) 238
Zsp2I ATGCAT 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.