RLG00000016112

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
OG0000544
Physical Location & Seq
Forward (+)
3987597 .. 3988784
1188 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000016112

Sequence Viewer

Length: 318 bp
ATGGTGAACGGGAAGAGGAAACCAAACACTGCCATGCCCATGGCGGTGAAGCGTGGTCGTAGGATACCCAATGGGGGAGTGATGGACCATGCTTTATATCGGTGGGATCATAAGTTACCCATTGGTGCATTGAACCCCACCAATGTGCGGGTTATTGATAATGCAGTTCTGCTGCCAGAGGTTGGGTCAGGACCTGAAGATTACAATTACGGCAGCAGAACCAAGGAATTTTCCACTGGGGTTTTTGTGCAACCAGGGGATTGGGAAGATAAAGATCATTTCCTATCACTGTTAGCTACTGCAGGGCTGAACAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

11.65

Weight (kDa)

9.45

Isoelectric Point (pI)

33.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 182
AciI CCGC 2 cut(s) 44, 148
AclWI GGATC 1 cut(s) 114
AcsI RAATTY 1 cut(s) 227
AcuI CTGAAG 1 cut(s) 216
AfiI CCNNNNNNNGG 3 cut(s) 74, 147, 182
AgsI TTSAA 1 cut(s) 133
AjnI CCWGG 1 cut(s) 253
AleI CACNNNNGTG 1 cut(s) 143
AluBI AGCT 1 cut(s) 296
AluI AGCT 1 cut(s) 296
AlwI GGATC 1 cut(s) 114
AlwNI CAGNNNCTG 1 cut(s) 194
ApeKI GCWGC 2 cut(s) 172, 213
ApoI RAATTY 1 cut(s) 227
AspS9I GGNCC 2 cut(s) 85, 191
AsuHPI GGTGA 2 cut(s) 16, 58
AvaII GGWCC 2 cut(s) 85, 191
BbvI GCAGC 2 cut(s) 159, 225
BccI CCATC 1 cut(s) 76
BceAI ACGGC 1 cut(s) 226
BciT130I CCWGG 1 cut(s) 255
BciVI GTATCC 1 cut(s) 57
BfmI CTRYAG 1 cut(s) 300
BfuI GTATCC 1 cut(s) 57
BisI GCNGC 2 cut(s) 173, 214
BlsI GCNGC 2 cut(s) 174, 215
Bme1390I CCNGG 1 cut(s) 255
Bme18I GGWCC 2 cut(s) 85, 191
BmgT120I GGNCC 2 cut(s) 85, 191
BmrFI CCNGG 1 cut(s) 255
BmrI ACTGGG 1 cut(s) 246
BmuI ACTGGG 1 cut(s) 246
BsaBI GATNNNNATC 1 cut(s) 273
BsaJI CCNNGG 3 cut(s) 39, 222, 254
Bsc4I CCNNNNNNNGG 3 cut(s) 74, 147, 182
Bse1I ACTGG 1 cut(s) 241
Bse8I GATNNNNATC 1 cut(s) 273
BseBI CCWGG 1 cut(s) 255
BseDI CCNNGG 3 cut(s) 39, 222, 254
BseJI GATNNNNATC 1 cut(s) 273
BseLI CCNNNNNNNGG 3 cut(s) 74, 147, 182
BseNI ACTGG 1 cut(s) 241
BseXI GCAGC 2 cut(s) 159, 225
BslI CCNNNNNNNGG 3 cut(s) 74, 147, 182
Bsp143I GATC 2 cut(s) 106, 274
Bsp19I CCATGG 1 cut(s) 39
BspACI CCGC 2 cut(s) 44, 148
BspMAI CTGCAG 1 cut(s) 304
BspPI GGATC 1 cut(s) 114
BsrI ACTGG 1 cut(s) 241
BssECI CCNNGG 3 cut(s) 39, 222, 254
BssMI GATC 2 cut(s) 106, 274
BssT1I CCWWGG 2 cut(s) 39, 222
Bst2UI CCWGG 1 cut(s) 255
Bst4CI ACNGT 1 cut(s) 291
Bst6I CTCTTC 1 cut(s) 8
BstDSI CCRYGG 1 cut(s) 39
BstKTI GATC 2 cut(s) 109, 277
BstMBI GATC 2 cut(s) 106, 274
BstNI CCWGG 1 cut(s) 255
BstSCI CCNGG 1 cut(s) 253
BstSFI CTRYAG 1 cut(s) 300
BstV1I GCAGC 2 cut(s) 159, 225
BstXI CCANNNNNNTGG 2 cut(s) 40, 261
BsuI GTATCC 1 cut(s) 57
BtgI CCRYGG 1 cut(s) 39
BtsI GCAGTG 1 cut(s) 27
BtsIMutI CAGTG 3 cut(s) 27, 234, 287
CaiI CAGNNNCTG 1 cut(s) 194
Cfr13I GGNCC 2 cut(s) 85, 191
CviAII CATG 3 cut(s) 34, 40, 89
CviJI RGCY 2 cut(s) 296, 307
CviKI_1 RGCY 2 cut(s) 296, 307
DpnI GATC 2 cut(s) 108, 276
DpnII GATC 2 cut(s) 106, 274
Eam1104I CTCTTC 1 cut(s) 8
EarI CTCTTC 1 cut(s) 8
Eco130I CCWWGG 2 cut(s) 39, 222
Eco47I GGWCC 2 cut(s) 85, 191
Eco57I CTGAAG 1 cut(s) 216
EcoO109I RGGNCCY 1 cut(s) 191
EcoRII CCWGG 1 cut(s) 253
EcoT14I CCWWGG 2 cut(s) 39, 222
ErhI CCWWGG 2 cut(s) 39, 222
FaeI CATG 3 cut(s) 37, 43, 92
FaiI YATR 5 cut(s) 35, 41, 90, 97, 111
FatI CATG 3 cut(s) 33, 39, 88
FauI CCCGC 1 cut(s) 141
Fnu4HI GCNGC 2 cut(s) 173, 214
Fsp4HI GCNGC 2 cut(s) 173, 214
GluI GCNGC 2 cut(s) 173, 214
Hin1II CATG 3 cut(s) 37, 43, 92
HphI GGTGA 2 cut(s) 16, 58
Hpy166II GTNNAC 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 189
Hpy8I GTNNAC 1 cut(s) 7
HpyCH4III ACNGT 1 cut(s) 291
HpyCH4V TGCA 4 cut(s) 128, 164, 250, 302
Hsp92II CATG 3 cut(s) 37, 43, 92
Kzo9I GATC 2 cut(s) 106, 274
LpnPI CCDG 8 cut(s) 174, 189, 207, 222, 240, 267, 288, 298
Lsp1109I GCAGC 2 cut(s) 159, 225
MaeIII GTNAC 1 cut(s) 114
MalI GATC 2 cut(s) 108, 276
MboI GATC 2 cut(s) 106, 274
MboII GAAGA 3 cut(s) 25, 209, 278
MluCI AATT 2 cut(s) 205, 227
MnlI CCTC 2 cut(s) 9, 172
MslI CAYNNNNRTG 4 cut(s) 32, 38, 44, 143
MspR9I CCNGG 1 cut(s) 255
MvaI CCWGG 1 cut(s) 255
NcoI CCATGG 1 cut(s) 39
NdeII GATC 2 cut(s) 106, 274
NlaIII CATG 3 cut(s) 37, 43, 92
OliI CACNNNNGTG 1 cut(s) 143
PflMI CCANNNNNTGG 1 cut(s) 182
PkrI GCNGC 2 cut(s) 174, 215
PpuMI RGGWCCY 1 cut(s) 191
Psp5II RGGWCCY 1 cut(s) 191
Psp6I CCWGG 1 cut(s) 253
PspGI CCWGG 1 cut(s) 253
PspPI GGNCC 2 cut(s) 85, 191
PspPPI RGGWCCY 1 cut(s) 191
PstI CTGCAG 1 cut(s) 304
PstNI CAGNNNCTG 1 cut(s) 194
RseI CAYNNNNRTG 4 cut(s) 32, 38, 44, 143
SatI GCNGC 2 cut(s) 173, 214
Sau3AI GATC 2 cut(s) 106, 274
Sau96I GGNCC 2 cut(s) 85, 191
ScrFI CCNGG 1 cut(s) 255
SetI ASST 4 cut(s) 183, 196, 298, 317
SfcI CTRYAG 1 cut(s) 300
SinI GGWCC 2 cut(s) 85, 191
SmiMI CAYNNNNRTG 4 cut(s) 32, 38, 44, 143
Sse9I AATT 2 cut(s) 205, 227
SsiI CCGC 2 cut(s) 44, 148
StyD4I CCNGG 1 cut(s) 253
StyI CCWWGG 2 cut(s) 39, 222
TaaI ACNGT 1 cut(s) 291
TasI AATT 2 cut(s) 205, 227
TscAI CASTG 3 cut(s) 34, 241, 294
TseI GCWGC 2 cut(s) 172, 213
TspRI CASTG 3 cut(s) 34, 241, 294
Van91I CCANNNNNTGG 1 cut(s) 182
VpaK11BI GGWCC 2 cut(s) 85, 191
XapI RAATTY 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.