FvH4_3g27831

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0000710
Physical Location & Seq
Forward (+)
20852977 .. 20853510
534 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g27831.t1

Sequence Viewer

Length: 261 bp
ATGTCTGTTATTGGGGGAGGTATTTCTCAAACCACTCCCTCCACCATAAAATGGCTACCTCCTCACAACAACTTCATCAAGATTAACTTTGATGGTTCTGTTCAAAAAAGATCAGTTGCAGGAGGTTTCGTTGATGGGAACGTGATTCTCGCTGCTGCAAAAGGCCACCAACTCCCTAATGGTCGTGAGTGGCAAGATGGCTACCCAACAGCTGCTGCTAGAGCGCTACTATTTGATACTGTTAGCTCAGGTTGTCCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

87

Amino Acids

9.04

Weight (kDa)

9.03

Isoelectric Point (pI)

39.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 51
AfeI AGCGCT 1 cut(s) 225
AfiI CCNNNNNNNGG 1 cut(s) 51
AgsI TTSAA 1 cut(s) 104
AluBI AGCT 2 cut(s) 212, 246
AluI AGCT 2 cut(s) 212, 246
AlwNI CAGNNNCTG 1 cut(s) 215
Aor51HI AGCGCT 1 cut(s) 225
AoxI GGCC 1 cut(s) 163
ApeKI GCWGC 4 cut(s) 152, 155, 212, 215
AspLEI GCGC 1 cut(s) 226
BbvI GCAGC 4 cut(s) 139, 142, 199, 202
BccI CCATC 3 cut(s) 86, 128, 191
BfaI CTAG 1 cut(s) 219
BfoI RGCGCY 1 cut(s) 227
BisI GCNGC 4 cut(s) 153, 156, 213, 216
BlsI GCNGC 4 cut(s) 154, 157, 214, 217
Bpu10I CCTNAGC 1 cut(s) 247
BsaXI ACNNNNNCTCC 2 cut(s) 114, 144
Bsc4I CCNNNNNNNGG 1 cut(s) 51
BseLI CCNNNNNNNGG 1 cut(s) 51
BseMII CTCAG 1 cut(s) 261
BseRI GAGGAG 1 cut(s) 51
BseXI GCAGC 4 cut(s) 139, 142, 199, 202
BshFI GGCC 1 cut(s) 165
BslI CCNNNNNNNGG 1 cut(s) 51
BsnI GGCC 1 cut(s) 165
Bsp143I GATC 1 cut(s) 110
BspANI GGCC 1 cut(s) 165
BspCNI CTCAG 1 cut(s) 260
BssMI GATC 1 cut(s) 110
Bst4CI ACNGT 1 cut(s) 241
BstDEI CTNAG 1 cut(s) 247
BstH2I RGCGCY 1 cut(s) 227
BstHHI GCGC 1 cut(s) 226
BstKTI GATC 1 cut(s) 113
BstMBI GATC 1 cut(s) 110
BstMWI GCNNNNNNNGC 1 cut(s) 221
BstV1I GCAGC 4 cut(s) 139, 142, 199, 202
BsuRI GGCC 1 cut(s) 165
CaiI CAGNNNCTG 1 cut(s) 215
CfoI GCGC 1 cut(s) 226
CviJI RGCY 5 cut(s) 55, 165, 201, 212, 246
CviKI_1 RGCY 5 cut(s) 55, 165, 201, 212, 246
DdeI CTNAG 1 cut(s) 247
DpnI GATC 1 cut(s) 112
DpnII GATC 1 cut(s) 110
Eco47III AGCGCT 1 cut(s) 225
FaiI YATR 1 cut(s) 47
FalI AAGNNNNNCTT 2 cut(s) 71, 103
Fnu4HI GCNGC 4 cut(s) 153, 156, 213, 216
Fsp4HI GCNGC 4 cut(s) 153, 156, 213, 216
FspBI CTAG 1 cut(s) 219
GlaI GCGC 1 cut(s) 225
GluI GCNGC 4 cut(s) 153, 156, 213, 216
HaeII RGCGCY 1 cut(s) 227
HaeIII GGCC 1 cut(s) 165
HhaI GCGC 1 cut(s) 226
Hin6I GCGC 1 cut(s) 224
HinP1I GCGC 1 cut(s) 224
HinfI GANTC 1 cut(s) 145
Hpy188III TCNNGA 2 cut(s) 79, 185
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4IV ACGT 1 cut(s) 141
HpyCH4V TGCA 2 cut(s) 119, 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 221
HpyF3I CTNAG 1 cut(s) 247
HpySE526I ACGT 1 cut(s) 141
HspAI GCGC 1 cut(s) 224
Kzo9I GATC 1 cut(s) 110
LpnPI CCDG 2 cut(s) 105, 234
Lsp1109I GCAGC 4 cut(s) 139, 142, 199, 202
MaeI CTAG 1 cut(s) 219
MaeII ACGT 1 cut(s) 141
MalI GATC 1 cut(s) 112
MboI GATC 1 cut(s) 110
MnlI CCTC 5 cut(s) 11, 49, 69, 72, 116
MseI TTAA 1 cut(s) 84
MspA1I CMGCKG 1 cut(s) 212
MwoI GCNNNNNNNGC 1 cut(s) 221
NdeII GATC 1 cut(s) 110
PfeI GAWTC 1 cut(s) 145
PflMI CCANNNNNTGG 1 cut(s) 51
PkrI GCNGC 4 cut(s) 154, 157, 214, 217
PstNI CAGNNNCTG 1 cut(s) 215
PvuII CAGCTG 1 cut(s) 212
SaqAI TTAA 1 cut(s) 84
SatI GCNGC 4 cut(s) 153, 156, 213, 216
Sau3AI GATC 1 cut(s) 110
SetI ASST 7 cut(s) 22, 61, 127, 144, 214, 248, 253
SgeI CNNG 7 cut(s) 91, 132, 154, 161, 197, 206, 231
SspMI CTAG 1 cut(s) 219
TaaI ACNGT 1 cut(s) 241
TaiI ACGT 1 cut(s) 144
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TseI GCWGC 4 cut(s) 152, 155, 212, 215
TspDTI ATGAA 1 cut(s) 64
TspGWI ACGGA 1 cut(s) 246
Van91I CCANNNNNTGG 1 cut(s) 51
XcmI CCANNNNNNNNNTGG 1 cut(s) 176
XspI CTAG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.