Rmu_sc0010161.1_g000019

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010161.1
Physical Location & Seq
Forward (+)
32496 .. 32924
429 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010161.1_g000019.1.cds

Sequence Viewer

Length: 429 bp
atgacttatgctaatcccacttcagttgtggtaatctcggctacagttttgaacattttcattaatgaaaattctccaagcactagagaagatactacccaaaaccatccaaccactatcatatggcagtcatttcctagtaattgtgtcaaattaaactttgatggatatgtaaacagggtctcttctgctgggggatttatcattcgagactccgatgataatcctctccttgcagctagcaaaaatttggggaatgcaactgtaccagtggcagaagtaacatctctttgtgatagtattatcaatactcagcaaaaatgttatctcaatgtccaagtagaaggagactcaaaccttgtcatagactcggtaaatggtgccatatctccaccttggaggcttatcaaagttgttcaagacatctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

142

Amino Acids

15.4

Weight (kDa)

4.55

Isoelectric Point (pI)

34.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 380
AcsI RAATTY 2 cut(s) 70, 247
AcuI CTGAAG 1 cut(s) 6
AfaI GTAC 1 cut(s) 267
AgsI TTSAA 2 cut(s) 52, 419
AluBI AGCT 1 cut(s) 239
AluI AGCT 1 cut(s) 239
Alw26I GTCTC 3 cut(s) 187, 204, 342
ApeKI GCWGC 1 cut(s) 236
ApoI RAATTY 2 cut(s) 70, 247
AseI ATTAAT 1 cut(s) 63
Asp700I GAANNNNTTC 1 cut(s) 56
AsuNHI GCTAGC 1 cut(s) 239
BanI GGYRCC 1 cut(s) 380
BbvI GCAGC 1 cut(s) 248
BccI CCATC 2 cut(s) 114, 158
BcoDI GTCTC 3 cut(s) 187, 204, 342
BfaI CTAG 3 cut(s) 84, 138, 240
BfmI CTRYAG 1 cut(s) 42
BisI GCNGC 1 cut(s) 237
BlsI GCNGC 1 cut(s) 238
BmiI GGNNCC 1 cut(s) 382
BmtI GCTAGC 1 cut(s) 243
BsaBI GATNNNNATC 1 cut(s) 222
BsaI GGTCTC 1 cut(s) 187
BsaJI CCNNGG 1 cut(s) 395
Bse1I ACTGG 1 cut(s) 269
Bse8I GATNNNNATC 1 cut(s) 222
BseDI CCNNGG 1 cut(s) 395
BseGI GGATG 1 cut(s) 106
BseJI GATNNNNATC 1 cut(s) 222
BseMII CTCAG 1 cut(s) 326
BseNI ACTGG 1 cut(s) 269
BseXI GCAGC 1 cut(s) 248
BseYI CCCAGC 1 cut(s) 191
BshNI GGYRCC 1 cut(s) 380
BsmAI GTCTC 3 cut(s) 187, 204, 342
BsmI GAATGC 1 cut(s) 262
Bso31I GGTCTC 1 cut(s) 187
BspCNI CTCAG 1 cut(s) 325
BspLI GGNNCC 1 cut(s) 382
BspOI GCTAGC 1 cut(s) 243
BspT107I GGYRCC 1 cut(s) 380
BspTNI GGTCTC 1 cut(s) 187
BsrI ACTGG 1 cut(s) 269
BssECI CCNNGG 1 cut(s) 395
BssT1I CCWWGG 1 cut(s) 395
Bst4CI ACNGT 2 cut(s) 46, 265
Bst6I CTCTTC 1 cut(s) 190
BstC8I GCNNGC 1 cut(s) 241
BstDEI CTNAG 1 cut(s) 312
BstF5I GGATG 1 cut(s) 106
BstMAI GTCTC 3 cut(s) 187, 204, 342
BstSFI CTRYAG 1 cut(s) 42
BstV1I GCAGC 1 cut(s) 248
BtsCI GGATG 1 cut(s) 106
BtsIMutI CAGTG 1 cut(s) 276
Cac8I GCNNGC 1 cut(s) 241
Csp6I GTAC 1 cut(s) 266
CspCI CAANNNNNGTGG 2 cut(s) 7, 42
CviJI RGCY 3 cut(s) 41, 239, 403
CviKI_1 RGCY 3 cut(s) 41, 239, 403
CviQI GTAC 1 cut(s) 266
DdeI CTNAG 1 cut(s) 312
Eam1104I CTCTTC 1 cut(s) 190
EarI CTCTTC 1 cut(s) 190
Eco130I CCWWGG 1 cut(s) 395
Eco31I GGTCTC 1 cut(s) 187
Eco57I CTGAAG 1 cut(s) 6
EcoT14I CCWWGG 1 cut(s) 395
ErhI CCWWGG 1 cut(s) 395
FaiI YATR 6 cut(s) 9, 122, 124, 171, 365, 386
FauNDI CATATG 1 cut(s) 122
Fnu4HI GCNGC 1 cut(s) 237
FokI GGATG 1 cut(s) 93
Fsp4HI GCNGC 1 cut(s) 237
FspBI CTAG 3 cut(s) 84, 138, 240
GluI GCNGC 1 cut(s) 237
GsaI CCCAGC 1 cut(s) 195
HinfI GANTC 3 cut(s) 212, 350, 368
Hpy166II GTNNAC 1 cut(s) 175
Hpy188I TCNGA 1 cut(s) 217
Hpy188III TCNNGA 2 cut(s) 209, 419
Hpy8I GTNNAC 1 cut(s) 175
HpyAV CCTTC 1 cut(s) 338
HpyCH4III ACNGT 2 cut(s) 46, 265
HpyCH4V TGCA 2 cut(s) 236, 260
HpyF3I CTNAG 1 cut(s) 312
LpnPI CCDG 3 cut(s) 163, 177, 282
Lsp1109I GCAGC 1 cut(s) 248
MaeI CTAG 3 cut(s) 84, 138, 240
MaeIII GTNAC 1 cut(s) 280
MboII GAAGA 2 cut(s) 101, 177
MluCI AATT 4 cut(s) 70, 142, 152, 247
MlyI GAGTC 3 cut(s) 206, 344, 362
MmeI TCCRAC 1 cut(s) 134
MnlI CCTC 2 cut(s) 237, 393
MroXI GAANNNNTTC 1 cut(s) 56
MseI TTAA 2 cut(s) 63, 155
Mva1269I GAATGC 1 cut(s) 262
NdeI CATATG 1 cut(s) 122
NheI GCTAGC 1 cut(s) 239
NlaIV GGNNCC 1 cut(s) 382
NmeAIII GCCGAG 1 cut(s) 17
PctI GAATGC 1 cut(s) 262
PdmI GAANNNNTTC 1 cut(s) 56
PkrI GCNGC 1 cut(s) 238
PleI GAGTC 3 cut(s) 206, 344, 362
PpsI GAGTC 3 cut(s) 206, 344, 362
PshBI ATTAAT 1 cut(s) 63
PspFI CCCAGC 1 cut(s) 191
PspN4I GGNNCC 1 cut(s) 382
RsaI GTAC 1 cut(s) 267
RsaNI GTAC 1 cut(s) 266
SaqAI TTAA 2 cut(s) 63, 155
SatI GCNGC 1 cut(s) 237
SchI GAGTC 3 cut(s) 206, 344, 362
SetI ASST 3 cut(s) 241, 360, 397
SfcI CTRYAG 1 cut(s) 42
Sse9I AATT 4 cut(s) 70, 142, 152, 247
SspMI CTAG 3 cut(s) 84, 138, 240
StyI CCWWGG 1 cut(s) 395
TaaI ACNGT 2 cut(s) 46, 265
TaqI TCGA 1 cut(s) 208
TasI AATT 4 cut(s) 70, 142, 152, 247
Tru1I TTAA 2 cut(s) 63, 155
Tru9I TTAA 2 cut(s) 63, 155
TscAI CASTG 1 cut(s) 276
TseI GCWGC 1 cut(s) 236
TspDTI ATGAA 2 cut(s) 49, 81
TspRI CASTG 1 cut(s) 276
VspI ATTAAT 1 cut(s) 63
XapI RAATTY 2 cut(s) 70, 247
XcmI CCANNNNNNNNNTGG 1 cut(s) 25
XmnI GAANNNNTTC 1 cut(s) 56
XspI CTAG 3 cut(s) 84, 138, 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.