Rmu_co8304929.1_g000001

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8304929.1
OG0000710
Physical Location & Seq
Forward (+)
367 .. 759
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8304929.1_g000001.1.cds

Sequence Viewer

Length: 393 bp
atgcataagctagaagaattggtgagaattcagttcccacggtggaagctcttactctccaaggcagcattctttcggcaagatacagatttcactaatgtctacgtggaaggagacttaatgcttgtaattgattgtgtcaatggtgtgactaatccttcatgcagattgaagaagattgttcatgacatccaacacattgctaaggctttcaattgcatttatttcaagcatgttttcagagaagcaaactttgttgctaatgcaattgccagcattagtcatgcttatccagatagcgggatttggaaaaacaccataccgtttcaagcttctagagccattttattcaactgtttagaaccaggttgccctaaagccttttttatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

130

Amino Acids

14.93

Weight (kDa)

8.88

Isoelectric Point (pI)

29.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 102
AciI CCGC 1 cut(s) 300
AcsI RAATTY 1 cut(s) 27
AfiI CCNNNNNNNGG 1 cut(s) 299
AgsI TTSAA 5 cut(s) 172, 214, 229, 329, 352
AjnI CCWGG 1 cut(s) 364
AjuI GAANNNNNNNTTGG 2 cut(s) 53, 85
AluBI AGCT 3 cut(s) 10, 49, 332
AluI AGCT 3 cut(s) 10, 49, 332
Alw26I GTCTC 1 cut(s) 108
ApeKI GCWGC 1 cut(s) 65
ApoI RAATTY 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 34
BbvI GCAGC 1 cut(s) 77
BciT130I CCWGG 1 cut(s) 366
BcoDI GTCTC 1 cut(s) 108
BfaI CTAG 2 cut(s) 11, 336
BisI GCNGC 1 cut(s) 66
BlsI GCNGC 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 366
BmrFI CCNGG 1 cut(s) 366
Bpu10I CCTNAGC 1 cut(s) 204
BsaAI YACGTR 1 cut(s) 106
BsaJI CCNNGG 2 cut(s) 38, 60
Bsc4I CCNNNNNNNGG 1 cut(s) 299
Bse3DI GCAATG 1 cut(s) 198
BseBI CCWGG 1 cut(s) 366
BseDI CCNNGG 2 cut(s) 38, 60
BseGI GGATG 1 cut(s) 189
BseLI CCNNNNNNNGG 1 cut(s) 299
BseMI GCAATG 1 cut(s) 198
BseXI GCAGC 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 299
BsmAI GTCTC 1 cut(s) 108
BsmI GAATGC 1 cut(s) 68
BspACI CCGC 1 cut(s) 300
BspHI TCATGA 1 cut(s) 184
BsrDI GCAATG 1 cut(s) 198
BssECI CCNNGG 2 cut(s) 38, 60
BssT1I CCWWGG 1 cut(s) 60
Bst2UI CCWGG 1 cut(s) 366
Bst4CI ACNGT 3 cut(s) 42, 324, 356
BstBAI YACGTR 1 cut(s) 106
BstC8I GCNNGC 1 cut(s) 274
BstDEI CTNAG 1 cut(s) 204
BstDSI CCRYGG 1 cut(s) 38
BstF5I GGATG 1 cut(s) 189
BstMAI GTCTC 1 cut(s) 108
BstMWI GCNNNNNNNGC 1 cut(s) 338
BstNI CCWGG 1 cut(s) 366
BstNSI RCATGY 1 cut(s) 236
BstSCI CCNGG 1 cut(s) 364
BstV1I GCAGC 1 cut(s) 77
BtgI CCRYGG 1 cut(s) 38
BtsCI GGATG 1 cut(s) 189
Cac8I GCNNGC 1 cut(s) 274
CciI TCATGA 1 cut(s) 184
CsiI ACCWGGT 1 cut(s) 364
CviAII CATG 4 cut(s) 162, 185, 233, 284
CviJI RGCY 6 cut(s) 10, 49, 209, 332, 341, 380
CviKI_1 RGCY 6 cut(s) 10, 49, 209, 332, 341, 380
DdeI CTNAG 1 cut(s) 204
Eco130I CCWWGG 1 cut(s) 60
EcoRI GAATTC 1 cut(s) 27
EcoRII CCWGG 1 cut(s) 364
EcoT14I CCWWGG 1 cut(s) 60
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 60
FaeI CATG 4 cut(s) 165, 188, 236, 287
FaiI YATR 6 cut(s) 6, 163, 186, 234, 285, 320
FatI CATG 4 cut(s) 161, 184, 232, 283
FauI CCCGC 1 cut(s) 293
FblI GTMKAC 1 cut(s) 102
Fnu4HI GCNGC 1 cut(s) 66
FokI GGATG 1 cut(s) 176
Fsp4HI GCNGC 1 cut(s) 66
FspBI CTAG 2 cut(s) 11, 336
GluI GCNGC 1 cut(s) 66
Hin1II CATG 4 cut(s) 165, 188, 236, 287
HindIII AAGCTT 1 cut(s) 330
HphI GGTGA 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 1 cut(s) 242
Hpy188III TCNNGA 3 cut(s) 185, 293, 336
Hpy8I GTNNAC 1 cut(s) 103
HpyAV CCTTC 2 cut(s) 104, 168
HpyCH4III ACNGT 3 cut(s) 42, 324, 356
HpyCH4IV ACGT 1 cut(s) 105
HpyCH4V TGCA 4 cut(s) 4, 165, 219, 266
HpyF10VI GCNNNNNNNGC 1 cut(s) 338
HpyF3I CTNAG 1 cut(s) 204
HpySE526I ACGT 1 cut(s) 105
Hsp92II CATG 4 cut(s) 165, 188, 236, 287
LpnPI CCDG 4 cut(s) 286, 306, 351, 378
Lsp1109I GCAGC 1 cut(s) 77
MabI ACCWGGT 1 cut(s) 364
MaeI CTAG 2 cut(s) 11, 336
MaeII ACGT 1 cut(s) 105
MaeIII GTNAC 1 cut(s) 148
MboII GAAGA 3 cut(s) 26, 184, 187
MfeI CAATTG 2 cut(s) 214, 267
MluCI AATT 5 cut(s) 17, 27, 129, 214, 267
MmeI TCCRAC 1 cut(s) 217
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 119, 391
MspR9I CCNGG 1 cut(s) 366
MunI CAATTG 2 cut(s) 214, 267
Mva1269I GAATGC 1 cut(s) 68
MvaI CCWGG 1 cut(s) 366
MwoI GCNNNNNNNGC 1 cut(s) 338
NlaIII CATG 4 cut(s) 165, 188, 236, 287
NmuCI GTSAC 1 cut(s) 148
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 236
PagI TCATGA 1 cut(s) 184
PctI GAATGC 1 cut(s) 68
PkrI GCNGC 1 cut(s) 67
Ppu21I YACGTR 1 cut(s) 106
Psp6I CCWGG 1 cut(s) 364
PspGI CCWGG 1 cut(s) 364
SaqAI TTAA 2 cut(s) 119, 391
SatI GCNGC 1 cut(s) 66
ScrFI CCNGG 1 cut(s) 366
SetI ASST 5 cut(s) 12, 51, 108, 334, 370
SexAI ACCWGGT 1 cut(s) 364
Sse9I AATT 5 cut(s) 17, 27, 129, 214, 267
SsiI CCGC 1 cut(s) 300
SspMI CTAG 2 cut(s) 11, 336
StyD4I CCNGG 1 cut(s) 364
StyI CCWWGG 1 cut(s) 60
TaaI ACNGT 3 cut(s) 42, 324, 356
TaiI ACGT 1 cut(s) 108
TasI AATT 5 cut(s) 17, 27, 129, 214, 267
Tru1I TTAA 2 cut(s) 119, 391
Tru9I TTAA 2 cut(s) 119, 391
TseFI GTSAC 1 cut(s) 148
TseI GCWGC 1 cut(s) 65
Tsp45I GTSAC 1 cut(s) 148
TspDTI ATGAA 2 cut(s) 150, 173
XapI RAATTY 1 cut(s) 27
XbaI TCTAGA 1 cut(s) 335
XceI RCATGY 1 cut(s) 236
XmiI GTMKAC 1 cut(s) 102
XspI CTAG 2 cut(s) 11, 336
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.