Rmu_sc0001211.1_g000044

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001211.1
OG0000710
Physical Location & Seq
Forward (+)
157945 .. 158631
687 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001211.1_g000044.1.cds

Sequence Viewer

Length: 612 bp
atgctgtcaaaggaagtctggaggctttctaatcttgatgatttgccttggaatgaaggctaccttcaagtcttgaggaatctgtttatccaacaaccctctaaccgtggcctatttgtcaagctcctaactttatgctggcaaatttggaaagctaggaatgatgctattttccgtggagttatctcctgtcccagagctattgtcgcagcagcagcggcttttcaaaacactcaaattcaggaaaggcgggcctctggtggaggcacttggcaaaaatttatccgcaccatcgtgtggcaccctccaccgacagaagctgtgaaaatcaattttgacggttcaagacaaggttcttctacagcagggggatttgtaatctggaatagggaaggtcaacccctatacgcggctgctaaaggttttggaaatactatggtcgaaggcgatgccaaggtggttattgatgctgtcatgggaagaacgccacccccttggaggatcgctaagattatccaagacattagacaccttgcctctagatttaccataatctccttgactccttcagacatatttatagagaggcaaattttgtcaccgattctatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

203

Amino Acids

22.83

Weight (kDa)

10.16

Isoelectric Point (pI)

41.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 300
AccB7I CCANNNNNTGG 1 cut(s) 297
AccII CGCG 1 cut(s) 410
AciI CCGC 4 cut(s) 218, 250, 286, 410
AclWI GGATC 1 cut(s) 509
AcsI RAATTY 4 cut(s) 144, 237, 278, 591
AcuI CTGAAG 1 cut(s) 552
AfiI CCNNNNNNNGG 3 cut(s) 297, 409, 498
AgsI TTSAA 3 cut(s) 68, 227, 345
AleI CACNNNNGTG 1 cut(s) 293
AluBI AGCT 4 cut(s) 124, 155, 200, 320
AluI AGCT 4 cut(s) 124, 155, 200, 320
AlwI GGATC 1 cut(s) 509
AlwNI CAGNNNCTG 1 cut(s) 320
AoxI GGCC 2 cut(s) 109, 252
ApeKI GCWGC 4 cut(s) 209, 212, 215, 413
ApoI RAATTY 4 cut(s) 144, 237, 278, 591
AspS9I GGNCC 1 cut(s) 252
AsuHPI GGTGA 1 cut(s) 591
BanI GGYRCC 1 cut(s) 300
BbvI GCAGC 4 cut(s) 221, 224, 227, 400
BccI CCATC 1 cut(s) 299
BcgI CGANNNNNNTGC 2 cut(s) 431, 465
BfaI CTAG 2 cut(s) 156, 540
BfmI CTRYAG 2 cut(s) 360, 608
BisI GCNGC 6 cut(s) 210, 213, 216, 219, 411, 414
BlsI GCNGC 6 cut(s) 211, 214, 217, 220, 412, 415
BmgT120I GGNCC 1 cut(s) 252
BmiI GGNNCC 1 cut(s) 302
BmsI GCATC 3 cut(s) 154, 439, 457
BpmI CTGGAG 1 cut(s) 40
BpuEI CTTGAG 1 cut(s) 94
BsaJI CCNNGG 5 cut(s) 47, 106, 175, 453, 494
Bsc4I CCNNNNNNNGG 3 cut(s) 297, 409, 498
BseDI CCNNGG 5 cut(s) 47, 106, 175, 453, 494
BseLI CCNNNNNNNGG 3 cut(s) 297, 409, 498
BseXI GCAGC 4 cut(s) 221, 224, 227, 400
Bsh1236I CGCG 1 cut(s) 410
BshFI GGCC 2 cut(s) 111, 254
BshNI GGYRCC 1 cut(s) 300
BslFI GGGAC 1 cut(s) 177
BslI CCNNNNNNNGG 3 cut(s) 297, 409, 498
BsmFI GGGAC 1 cut(s) 177
BsnI GGCC 2 cut(s) 111, 254
Bsp143I GATC 1 cut(s) 501
BspACI CCGC 4 cut(s) 218, 250, 286, 410
BspANI GGCC 2 cut(s) 111, 254
BspFNI CGCG 1 cut(s) 410
BspLI GGNNCC 1 cut(s) 302
BspPI GGATC 1 cut(s) 509
BspT107I GGYRCC 1 cut(s) 300
BssECI CCNNGG 5 cut(s) 47, 106, 175, 453, 494
BssMI GATC 1 cut(s) 501
BssT1I CCWWGG 3 cut(s) 47, 453, 494
Bst4CI ACNGT 2 cut(s) 107, 341
BstC8I GCNNGC 2 cut(s) 140, 252
BstDEI CTNAG 1 cut(s) 507
BstDSI CCRYGG 2 cut(s) 106, 175
BstFNI CGCG 1 cut(s) 410
BstKTI GATC 1 cut(s) 504
BstMBI GATC 1 cut(s) 501
BstMWI GCNNNNNNNGC 3 cut(s) 206, 215, 218
BstSFI CTRYAG 2 cut(s) 360, 608
BstUI CGCG 1 cut(s) 410
BstV1I GCAGC 4 cut(s) 221, 224, 227, 400
BstXI CCANNNNNNTGG 1 cut(s) 495
BsuRI GGCC 2 cut(s) 111, 254
BtgI CCRYGG 2 cut(s) 106, 175
BtgZI GCGATG 1 cut(s) 462
Cac8I GCNNGC 2 cut(s) 140, 252
CaiI CAGNNNCTG 1 cut(s) 320
Cfr13I GGNCC 1 cut(s) 252
CviAII CATG 1 cut(s) 475
DdeI CTNAG 1 cut(s) 507
DpnI GATC 1 cut(s) 503
DpnII GATC 1 cut(s) 501
Eco130I CCWWGG 3 cut(s) 47, 453, 494
Eco57I CTGAAG 1 cut(s) 552
EcoT14I CCWWGG 3 cut(s) 47, 453, 494
ErhI CCWWGG 3 cut(s) 47, 453, 494
FaeI CATG 1 cut(s) 478
FaiI YATR 8 cut(s) 136, 406, 437, 476, 551, 575, 581, 610
FalI AAGNNNNNCTT 2 cut(s) 48, 80
FaqI GGGAC 1 cut(s) 177
FatI CATG 1 cut(s) 474
FauI CCCGC 1 cut(s) 243
Fnu4HI GCNGC 6 cut(s) 210, 213, 216, 219, 411, 414
Fsp4HI GCNGC 6 cut(s) 210, 213, 216, 219, 411, 414
FspBI CTAG 2 cut(s) 156, 540
GluI GCNGC 6 cut(s) 210, 213, 216, 219, 411, 414
GsuI CTGGAG 1 cut(s) 40
HaeIII GGCC 2 cut(s) 111, 254
Hin1II CATG 1 cut(s) 478
HincII GTYRAC 1 cut(s) 398
HindII GTYRAC 1 cut(s) 398
HinfI GANTC 3 cut(s) 79, 562, 604
HphI GGTGA 1 cut(s) 591
Hpy166II GTNNAC 1 cut(s) 398
Hpy188I TCNGA 1 cut(s) 571
Hpy188III TCNNGA 7 cut(s) 19, 35, 73, 242, 345, 382, 540
Hpy8I GTNNAC 1 cut(s) 398
HpyAV CCTTC 5 cut(s) 50, 74, 386, 437, 576
HpyCH4III ACNGT 2 cut(s) 107, 341
HpyF10VI GCNNNNNNNGC 3 cut(s) 206, 215, 218
HpyF3I CTNAG 1 cut(s) 507
Hsp92II CATG 1 cut(s) 478
Kzo9I GATC 1 cut(s) 501
LmnI GCTCC 1 cut(s) 129
LpnPI CCDG 8 cut(s) 4, 124, 202, 208, 227, 243, 351, 367
Lsp1109I GCAGC 4 cut(s) 221, 224, 227, 400
LweI GCATC 3 cut(s) 154, 439, 457
MaeI CTAG 2 cut(s) 156, 540
MaeIII GTNAC 1 cut(s) 597
MalI GATC 1 cut(s) 503
MboI GATC 1 cut(s) 501
MboII GAAGA 2 cut(s) 348, 492
MluCI AATT 5 cut(s) 144, 237, 278, 331, 591
MlyI GAGTC 1 cut(s) 556
MmeI TCCRAC 1 cut(s) 115
MnlI CCTC 9 cut(s) 15, 69, 109, 257, 265, 315, 492, 547, 579
MslI CAYNNNNRTG 1 cut(s) 293
MspA1I CMGCKG 1 cut(s) 218
MvnI CGCG 1 cut(s) 410
MwoI GCNNNNNNNGC 3 cut(s) 206, 215, 218
NdeII GATC 1 cut(s) 501
NlaIII CATG 1 cut(s) 478
NlaIV GGNNCC 1 cut(s) 302
NmuCI GTSAC 1 cut(s) 597
OliI CACNNNNGTG 1 cut(s) 293
PfeI GAWTC 2 cut(s) 79, 604
PflMI CCANNNNNTGG 1 cut(s) 297
PkrI GCNGC 6 cut(s) 211, 214, 217, 220, 412, 415
PleI GAGTC 1 cut(s) 556
PpsI GAGTC 1 cut(s) 556
PspN4I GGNNCC 1 cut(s) 302
PspPI GGNCC 1 cut(s) 252
PstNI CAGNNNCTG 1 cut(s) 320
RseI CAYNNNNRTG 1 cut(s) 293
SatI GCNGC 6 cut(s) 210, 213, 216, 219, 411, 414
Sau3AI GATC 1 cut(s) 501
Sau96I GGNCC 1 cut(s) 252
SchI GAGTC 1 cut(s) 556
SfaNI GCATC 3 cut(s) 154, 439, 457
SfcI CTRYAG 2 cut(s) 360, 608
SmiMI CAYNNNNRTG 1 cut(s) 293
SmlI CTYRAG 1 cut(s) 73
SmoI CTYRAG 1 cut(s) 73
Sse9I AATT 5 cut(s) 144, 237, 278, 331, 591
SsiI CCGC 4 cut(s) 218, 250, 286, 410
SspMI CTAG 2 cut(s) 156, 540
StyI CCWWGG 3 cut(s) 47, 453, 494
TaaI ACNGT 2 cut(s) 107, 341
TaqI TCGA 1 cut(s) 441
TasI AATT 5 cut(s) 144, 237, 278, 331, 591
TauI GCSGC 2 cut(s) 221, 413
TfiI GAWTC 2 cut(s) 79, 604
TseFI GTSAC 1 cut(s) 597
TseI GCWGC 4 cut(s) 209, 212, 215, 413
Tsp45I GTSAC 1 cut(s) 597
TspDTI ATGAA 1 cut(s) 69
TspGWI ACGGA 1 cut(s) 164
Van91I CCANNNNNTGG 1 cut(s) 297
XapI RAATTY 4 cut(s) 144, 237, 278, 591
XbaI TCTAGA 1 cut(s) 539
XspI CTAG 2 cut(s) 156, 540
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.