Rmu_sc0007034.1_g000034

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007034.1
OG0000710
Physical Location & Seq
Forward (+)
138556 .. 140539
1984 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007034.1_g000034.1.cds

Sequence Viewer

Length: 516 bp
atgtacattagaaatgcaaatggtaatcctttgtttgctgctaataagaagttaggaatcactaatgctcctggtgcagaagcaactgcattaagggatggtttacatactgcattacttcatcaatatgctaatgttttggttgaaggtgattctaagttgctagttgactgtattcaaggaagatgtgaggttctgttgaaaccgaaaaattcacaattccaattcgagaggggctacattcaaaagttacatgttggatcttcgtataattgtgaaaagacgattcaaaaggagatccgtgaggattcgaccgttggatcgtcgtataattttgtgaggatgattctaaaggcgatctgggacaatccaaccgttggatcttcgtataattgtgcaaagatgattcaaaaggcgatccgtgaggatcagacagttggatcttcgtataattttgagatgatgaacccaagggcgatccgtgaggatctgaccgttggatcatcgtataaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

171

Amino Acids

19.13

Weight (kDa)

8.86

Isoelectric Point (pI)

18.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 377
AcsI RAATTY 1 cut(s) 211
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 377
AflIII ACRYGT 1 cut(s) 253
AgsI TTSAA 6 cut(s) 146, 179, 202, 245, 290, 410
AjnI CCWGG 1 cut(s) 70
ApeKI GCWGC 1 cut(s) 38
ApoI RAATTY 1 cut(s) 211
AsuHPI GGTGA 1 cut(s) 161
BbvI GCAGC 1 cut(s) 25
BccI CCATC 1 cut(s) 92
BciT130I CCWGG 1 cut(s) 72
BfaI CTAG 1 cut(s) 164
BisI GCNGC 1 cut(s) 39
BlsI GCNGC 1 cut(s) 40
Bme1390I CCNGG 1 cut(s) 72
BmrFI CCNGG 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 470
BsaXI ACNNNNNCTCC 2 cut(s) 52, 82
Bsc4I CCNNNNNNNGG 1 cut(s) 377
BseBI CCWGG 1 cut(s) 72
BseDI CCNNGG 1 cut(s) 470
BseGI GGATG 2 cut(s) 103, 348
BseLI CCNNNNNNNGG 1 cut(s) 377
BseXI GCAGC 1 cut(s) 25
BsgI GTGCAG 1 cut(s) 96
Bsh1285I CGRYCG 1 cut(s) 315
BsiEI CGRYCG 1 cut(s) 315
BslFI GGGAC 1 cut(s) 377
BslI CCNNNNNNNGG 1 cut(s) 377
BsmFI GGGAC 1 cut(s) 377
Bsp1407I TGTACA 1 cut(s) 3
BsrGI TGTACA 1 cut(s) 3
BssECI CCNNGG 1 cut(s) 470
BssT1I CCWWGG 1 cut(s) 470
Bst2UI CCWGG 1 cut(s) 72
Bst4CI ACNGT 5 cut(s) 173, 316, 376, 436, 496
BstAUI TGTACA 1 cut(s) 3
BstDEI CTNAG 1 cut(s) 156
BstF5I GGATG 2 cut(s) 103, 348
BstMCI CGRYCG 1 cut(s) 315
BstMWI GCNNNNNNNGC 1 cut(s) 74
BstNI CCWGG 1 cut(s) 72
BstNSI RCATGY 1 cut(s) 257
BstSCI CCNGG 1 cut(s) 70
BstV1I GCAGC 1 cut(s) 25
BstX2I RGATCY 5 cut(s) 260, 297, 380, 440, 487
BstYI RGATCY 5 cut(s) 260, 297, 380, 440, 487
BtsCI GGATG 2 cut(s) 103, 348
Csp6I GTAC 1 cut(s) 4
CviAII CATG 1 cut(s) 254
CviJI RGCY 1 cut(s) 237
CviKI_1 RGCY 1 cut(s) 237
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 156
Eco130I CCWWGG 1 cut(s) 470
EcoRII CCWGG 1 cut(s) 70
EcoT14I CCWWGG 1 cut(s) 470
ErhI CCWWGG 1 cut(s) 470
FaeI CATG 1 cut(s) 257
FaiI YATR 8 cut(s) 108, 129, 255, 270, 330, 390, 450, 510
FaqI GGGAC 1 cut(s) 377
FatI CATG 1 cut(s) 253
Fnu4HI GCNGC 1 cut(s) 39
FokI GGATG 2 cut(s) 110, 355
Fsp4HI GCNGC 1 cut(s) 39
FspBI CTAG 1 cut(s) 164
GluI GCNGC 1 cut(s) 39
Hin1II CATG 1 cut(s) 257
HincII GTYRAC 1 cut(s) 169
HindII GTYRAC 1 cut(s) 169
HinfI GANTC 6 cut(s) 57, 152, 286, 308, 346, 406
HphI GGTGA 1 cut(s) 161
Hpy166II GTNNAC 2 cut(s) 104, 169
Hpy188I TCNGA 2 cut(s) 432, 492
Hpy188III TCNNGA 1 cut(s) 229
Hpy8I GTNNAC 2 cut(s) 104, 169
Hpy99I CGWCG 1 cut(s) 328
HpyAV CCTTC 1 cut(s) 140
HpyCH4III ACNGT 5 cut(s) 173, 316, 376, 436, 496
HpyCH4V TGCA 5 cut(s) 17, 77, 89, 113, 398
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 156
Hsp92II CATG 1 cut(s) 257
LmnI GCTCC 1 cut(s) 73
LpnPI CCDG 3 cut(s) 57, 84, 346
Lsp1109I GCAGC 1 cut(s) 25
MaeI CTAG 1 cut(s) 164
MaeIII GTNAC 1 cut(s) 249
MboII GAAGA 4 cut(s) 195, 255, 375, 435
MflI RGATCY 5 cut(s) 260, 297, 380, 440, 487
MluCI AATT 7 cut(s) 211, 218, 224, 271, 331, 391, 451
MmeI TCCRAC 6 cut(s) 238, 298, 358, 395, 418, 478
MnlI CCTC 6 cut(s) 184, 225, 298, 333, 418, 478
MseI TTAA 1 cut(s) 92
MslI CAYNNNNRTG 1 cut(s) 126
MspR9I CCNGG 1 cut(s) 72
MvaI CCWGG 1 cut(s) 72
MwoI GCNNNNNNNGC 1 cut(s) 74
NlaIII CATG 1 cut(s) 257
NspI RCATGY 1 cut(s) 257
PciI ACATGT 1 cut(s) 253
PfeI GAWTC 6 cut(s) 57, 152, 286, 308, 346, 406
PflMI CCANNNNNTGG 1 cut(s) 377
PkrI GCNGC 1 cut(s) 40
PscI ACATGT 1 cut(s) 253
Psp6I CCWGG 1 cut(s) 70
PspGI CCWGG 1 cut(s) 70
PsuI RGATCY 5 cut(s) 260, 297, 380, 440, 487
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
RseI CAYNNNNRTG 1 cut(s) 126
SaqAI TTAA 1 cut(s) 92
SatI GCNGC 1 cut(s) 39
ScrFI CCNGG 1 cut(s) 72
SetI ASST 2 cut(s) 151, 195
SmiMI CAYNNNNRTG 1 cut(s) 126
Sse9I AATT 7 cut(s) 211, 218, 224, 271, 331, 391, 451
SspMI CTAG 1 cut(s) 164
StyD4I CCNGG 1 cut(s) 70
StyI CCWWGG 1 cut(s) 470
TaaI ACNGT 5 cut(s) 173, 316, 376, 436, 496
TaqI TCGA 2 cut(s) 228, 311
TasI AATT 7 cut(s) 211, 218, 224, 271, 331, 391, 451
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 6 cut(s) 57, 152, 286, 308, 346, 406
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
TseI GCWGC 1 cut(s) 38
TspDTI ATGAA 2 cut(s) 110, 479
TspGWI ACGGA 3 cut(s) 290, 410, 470
Van91I CCANNNNNTGG 1 cut(s) 377
XapI RAATTY 1 cut(s) 211
XceI RCATGY 1 cut(s) 257
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.