Rorug04G0142000

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
23657109 .. 23657423
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0142000.1

Sequence Viewer

Length: 315 bp
ATGACTGCCCTGGCTAGTGATGGAGATGACTTGTCTGAGGTTGGTGCTATTTTAAGCGATTGTAAGTACCATTCACAGGCTTTAATTTTATCTACCTTAAACATGTCTTTCGTGAAGCAAATGGTGTTGCACAGACTTGCACACCTTGCTGCTACATCCATGTTGGATGAGTTTTGGGTAGATGACACTCCTAATATTATTCAGAATGTCTTGATTGAGGATGAATGTATTCCAACACGAAGTTTAGGCCCCTCGTTATACTCTCAAAATAGTATAAATAATAACGTAAGGAGGAGAACTATATCTTCAATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.54

Weight (kDa)

4.86

Isoelectric Point (pI)

53.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 68
AfiI CCNNNNNNNGG 1 cut(s) 76
AflIII ACRYGT 1 cut(s) 102
AgsI TTSAA 1 cut(s) 309
AjnI CCWGG 1 cut(s) 9
AoxI GGCC 1 cut(s) 247
ApeKI GCWGC 1 cut(s) 149
Asp700I GAANNNNTTC 1 cut(s) 228
AspS9I GGNCC 1 cut(s) 248
BbvI GCAGC 1 cut(s) 136
BccI CCATC 1 cut(s) 14
BciT130I CCWGG 1 cut(s) 11
BfaI CTAG 1 cut(s) 15
BisI GCNGC 1 cut(s) 150
BlsI GCNGC 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 11
BmgT120I GGNCC 1 cut(s) 248
BmiI GGNNCC 1 cut(s) 250
BmrFI CCNGG 1 cut(s) 11
BsaJI CCNNGG 1 cut(s) 9
Bsc4I CCNNNNNNNGG 1 cut(s) 76
BseBI CCWGG 1 cut(s) 11
BseDI CCNNGG 1 cut(s) 9
BseGI GGATG 3 cut(s) 155, 172, 226
BseLI CCNNNNNNNGG 1 cut(s) 76
BseMII CTCAG 1 cut(s) 27
BseRI GAGGAG 1 cut(s) 307
BseXI GCAGC 1 cut(s) 136
BshFI GGCC 1 cut(s) 249
BslI CCNNNNNNNGG 1 cut(s) 76
BsnI GGCC 1 cut(s) 249
BspANI GGCC 1 cut(s) 249
BspCNI CTCAG 1 cut(s) 28
BspLI GGNNCC 1 cut(s) 250
BssECI CCNNGG 1 cut(s) 9
Bst2UI CCWGG 1 cut(s) 11
BstAPI GCANNNNNTGC 1 cut(s) 146
BstDEI CTNAG 1 cut(s) 36
BstF5I GGATG 3 cut(s) 155, 172, 226
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstNI CCWGG 1 cut(s) 11
BstNSI RCATGY 1 cut(s) 106
BstSCI CCNGG 1 cut(s) 9
BstV1I GCAGC 1 cut(s) 136
BsuRI GGCC 1 cut(s) 249
BtsCI GGATG 3 cut(s) 155, 172, 226
Cfr13I GGNCC 1 cut(s) 248
Csp6I GTAC 1 cut(s) 67
CviAII CATG 2 cut(s) 103, 160
CviJI RGCY 3 cut(s) 14, 80, 249
CviKI_1 RGCY 3 cut(s) 14, 80, 249
CviQI GTAC 1 cut(s) 67
DdeI CTNAG 1 cut(s) 36
EcoO109I RGGNCCY 1 cut(s) 248
EcoRII CCWGG 1 cut(s) 9
FaeI CATG 2 cut(s) 106, 163
FaiI YATR 5 cut(s) 104, 161, 259, 275, 302
FatI CATG 2 cut(s) 102, 159
Fnu4HI GCNGC 1 cut(s) 150
FokI GGATG 3 cut(s) 142, 179, 233
Fsp4HI GCNGC 1 cut(s) 150
FspBI CTAG 1 cut(s) 15
GluI GCNGC 1 cut(s) 150
HaeIII GGCC 1 cut(s) 249
Hin1II CATG 2 cut(s) 106, 163
Hpy188I TCNGA 2 cut(s) 37, 204
Hpy188III TCNNGA 2 cut(s) 112, 211
HpyCH4IV ACGT 1 cut(s) 285
HpyCH4V TGCA 2 cut(s) 130, 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 1 cut(s) 36
HpySE526I ACGT 1 cut(s) 285
Hsp92II CATG 2 cut(s) 106, 163
LpnPI CCDG 2 cut(s) 23, 62
Lsp1109I GCAGC 1 cut(s) 136
MaeI CTAG 1 cut(s) 15
MaeII ACGT 1 cut(s) 285
MboII GAAGA 1 cut(s) 297
MluCI AATT 1 cut(s) 84
MmeI TCCRAC 2 cut(s) 144, 257
MnlI CCTC 4 cut(s) 31, 211, 262, 285
MroXI GAANNNNTTC 1 cut(s) 228
MseI TTAA 3 cut(s) 53, 83, 98
MspR9I CCNGG 1 cut(s) 11
MvaI CCWGG 1 cut(s) 11
MwoI GCNNNNNNNGC 1 cut(s) 146
NlaIII CATG 2 cut(s) 106, 163
NlaIV GGNNCC 1 cut(s) 250
NspI RCATGY 1 cut(s) 106
PciI ACATGT 1 cut(s) 102
PdmI GAANNNNTTC 1 cut(s) 228
PkrI GCNGC 1 cut(s) 151
PscI ACATGT 1 cut(s) 102
Psp6I CCWGG 1 cut(s) 9
PspGI CCWGG 1 cut(s) 9
PspN4I GGNNCC 1 cut(s) 250
PspPI GGNCC 1 cut(s) 248
RsaI GTAC 1 cut(s) 68
RsaNI GTAC 1 cut(s) 67
SaqAI TTAA 3 cut(s) 53, 83, 98
SatI GCNGC 1 cut(s) 150
Sau96I GGNCC 1 cut(s) 248
ScrFI CCNGG 1 cut(s) 11
SetI ASST 4 cut(s) 42, 98, 147, 288
Sse9I AATT 1 cut(s) 84
SspI AATATT 1 cut(s) 196
SspMI CTAG 1 cut(s) 15
StyD4I CCNGG 1 cut(s) 9
TaiI ACGT 1 cut(s) 288
TasI AATT 1 cut(s) 84
Tru1I TTAA 3 cut(s) 53, 83, 98
Tru9I TTAA 3 cut(s) 53, 83, 98
TseI GCWGC 1 cut(s) 149
TspDTI ATGAA 1 cut(s) 237
XceI RCATGY 1 cut(s) 106
XmnI GAANNNNTTC 1 cut(s) 228
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.