pycom05g31010

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0000710
Physical Location & Seq
Forward (+)
30909097 .. 30909348
252 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g31010.1

Sequence Viewer

Length: 252 bp
ATGGGTGAGATCGAAACACATGATCTGTTTTCTTTTGTAAAATACTTCTTTTCTCTACATAGATTAGTAGGAGGATGTGAATCGCCTTGGAGAACAATTATTGAAGATATCAAATCGCTTTCTTTTTTCTTCGATTATGTGAAGTATAATCATGTTTTTAGAGAAGCAAATTTCACGGCAGATGTTATTACTTCCGTAGGCCACCATGCTAGTAATATGTATTTGGGACGGGATGATCCCGCCTCAACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3

Protein Analysis

84

Amino Acids

9.61

Weight (kDa)

5.6

Isoelectric Point (pI)

33.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 240
AclWI GGATC 1 cut(s) 230
AcsI RAATTY 1 cut(s) 169
AgsI TTSAA 1 cut(s) 104
AlwI GGATC 1 cut(s) 230
AoxI GGCC 1 cut(s) 199
ApoI RAATTY 1 cut(s) 169
AsuHPI GGTGA 1 cut(s) 17
BceAI ACGGC 1 cut(s) 192
BfaI CTAG 1 cut(s) 210
BsaBI GATNNNNATC 1 cut(s) 79
BsaJI CCNNGG 1 cut(s) 86
Bse8I GATNNNNATC 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 86
BseGI GGATG 2 cut(s) 80, 238
BseJI GATNNNNATC 1 cut(s) 79
BshFI GGCC 1 cut(s) 201
BslFI GGGAC 1 cut(s) 240
BsmFI GGGAC 1 cut(s) 240
BsnI GGCC 1 cut(s) 201
Bsp143I GATC 3 cut(s) 9, 22, 235
BspACI CCGC 1 cut(s) 240
BspANI GGCC 1 cut(s) 201
BspPI GGATC 1 cut(s) 230
BssECI CCNNGG 1 cut(s) 86
BssMI GATC 3 cut(s) 9, 22, 235
BssT1I CCWWGG 1 cut(s) 86
BstF5I GGATG 2 cut(s) 80, 238
BstKTI GATC 3 cut(s) 12, 25, 238
BstMBI GATC 3 cut(s) 9, 22, 235
BsuRI GGCC 1 cut(s) 201
BtsCI GGATG 2 cut(s) 80, 238
CviAII CATG 3 cut(s) 20, 152, 206
CviJI RGCY 1 cut(s) 201
CviKI_1 RGCY 1 cut(s) 201
DpnI GATC 3 cut(s) 11, 24, 237
DpnII GATC 3 cut(s) 9, 22, 235
Eco130I CCWWGG 1 cut(s) 86
Eco32I GATATC 1 cut(s) 109
EcoRV GATATC 1 cut(s) 109
EcoT14I CCWWGG 1 cut(s) 86
ErhI CCWWGG 1 cut(s) 86
FaeI CATG 3 cut(s) 23, 155, 209
FaiI YATR 7 cut(s) 21, 60, 138, 147, 153, 207, 218
FaqI GGGAC 1 cut(s) 240
FatI CATG 3 cut(s) 19, 151, 205
FauI CCCGC 1 cut(s) 247
FokI GGATG 2 cut(s) 87, 245
FspBI CTAG 1 cut(s) 210
HaeIII GGCC 1 cut(s) 201
Hin1II CATG 3 cut(s) 23, 155, 209
HinfI GANTC 1 cut(s) 80
HphI GGTGA 1 cut(s) 17
Hsp92II CATG 3 cut(s) 23, 155, 209
Kzo9I GATC 3 cut(s) 9, 22, 235
MaeI CTAG 1 cut(s) 210
MalI GATC 3 cut(s) 11, 24, 237
MboI GATC 3 cut(s) 9, 22, 235
MboII GAAGA 2 cut(s) 116, 121
MluCI AATT 2 cut(s) 96, 169
MnlI CCTC 1 cut(s) 65
NdeII GATC 3 cut(s) 9, 22, 235
NlaIII CATG 3 cut(s) 23, 155, 209
PfeI GAWTC 1 cut(s) 80
Sau3AI GATC 3 cut(s) 9, 22, 235
SetI ASST 1 cut(s) 251
SgeI CNNG 7 cut(s) 32, 99, 164, 187, 218, 222, 242
Sse9I AATT 2 cut(s) 96, 169
SsiI CCGC 1 cut(s) 240
SspMI CTAG 1 cut(s) 210
StyI CCWWGG 1 cut(s) 86
TaqI TCGA 2 cut(s) 12, 132
TasI AATT 2 cut(s) 96, 169
TfiI GAWTC 1 cut(s) 80
TspGWI ACGGA 1 cut(s) 184
XapI RAATTY 1 cut(s) 169
XspI CTAG 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.