Rmu_sc0007497.1_g000003

Reverse transcriptase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007497.1
OG0000710
Physical Location & Seq
Reverse (-)
15224 .. 15589
366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007497.1_g000003.1.cds

Sequence Viewer

Length: 366 bp
atgctactgtaccgattgaggaagcgactgctctacgggatagccttgccactgcaaaggataggggctttcaattccttgaggttgagggagactcaaaacttgttagctgtcaacggagtctcccatccaccttggcgactgaggaaaatcattcaggacatccgatctcttgctacttcgttctctactatcacctttaaacatgtgtttagagaggccaattttactgctgactcagtcactaatcttggtcatcttcattctgatcgtatttggtgggctaatcgctttccacctgcggttgctagagctattttatttgactttgtaaactgtggaggccaacgttgcctgtgtatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3

Protein Analysis

121

Amino Acids

13.96

Weight (kDa)

11.28

Isoelectric Point (pI)

28.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 307
Acc36I ACCTGC 1 cut(s) 307
AciI CCGC 1 cut(s) 302
AclI AACGTT 1 cut(s) 349
AfaI GTAC 1 cut(s) 11
AflIII ACRYGT 1 cut(s) 205
AgsI TTSAA 1 cut(s) 73
AluBI AGCT 2 cut(s) 110, 314
AluI AGCT 2 cut(s) 110, 314
Alw26I GTCTC 2 cut(s) 86, 127
AoxI GGCC 2 cut(s) 219, 343
AsuHPI GGTGA 1 cut(s) 187
BccI CCATC 1 cut(s) 135
BcoDI GTCTC 2 cut(s) 86, 127
BfaI CTAG 1 cut(s) 309
BfuAI ACCTGC 1 cut(s) 307
BplI GAGNNNNNCTC 2 cut(s) 79, 111
BpuEI CTTGAG 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 134
BsaXI ACNNNNNCTCC 2 cut(s) 107, 137
BseDI CCNNGG 1 cut(s) 134
BseGI GGATG 2 cut(s) 127, 162
BseMII CTCAG 2 cut(s) 134, 252
BshFI GGCC 2 cut(s) 221, 345
BsmAI GTCTC 2 cut(s) 86, 127
BsnI GGCC 2 cut(s) 221, 345
Bsp143I GATC 2 cut(s) 167, 268
BspACI CCGC 1 cut(s) 302
BspANI GGCC 2 cut(s) 221, 345
BspCNI CTCAG 2 cut(s) 135, 251
BspMI ACCTGC 1 cut(s) 307
BssECI CCNNGG 1 cut(s) 134
BssMI GATC 2 cut(s) 167, 268
BssT1I CCWWGG 1 cut(s) 134
Bst4CI ACNGT 2 cut(s) 9, 338
BstDEI CTNAG 2 cut(s) 143, 238
BstF5I GGATG 2 cut(s) 127, 162
BstKTI GATC 2 cut(s) 170, 271
BstMAI GTCTC 2 cut(s) 86, 127
BstMBI GATC 2 cut(s) 167, 268
BstMWI GCNNNNNNNGC 1 cut(s) 351
BstNSI RCATGY 1 cut(s) 209
BsuRI GGCC 2 cut(s) 221, 345
BtsCI GGATG 2 cut(s) 127, 162
BtsI GCAGTG 1 cut(s) 50
BtsIMutI CAGTG 1 cut(s) 50
BveI ACCTGC 1 cut(s) 307
Csp6I GTAC 1 cut(s) 10
CviAII CATG 1 cut(s) 206
CviJI RGCY 7 cut(s) 44, 68, 110, 221, 284, 314, 345
CviKI_1 RGCY 7 cut(s) 44, 68, 110, 221, 284, 314, 345
CviQI GTAC 1 cut(s) 10
DdeI CTNAG 2 cut(s) 143, 238
DpnI GATC 2 cut(s) 169, 270
DpnII GATC 2 cut(s) 167, 268
DraI TTTAAA 1 cut(s) 202
Eco130I CCWWGG 1 cut(s) 134
EcoT14I CCWWGG 1 cut(s) 134
ErhI CCWWGG 1 cut(s) 134
FaeI CATG 1 cut(s) 209
FaiI YATR 1 cut(s) 207
FatI CATG 1 cut(s) 205
FokI GGATG 2 cut(s) 114, 149
FspBI CTAG 1 cut(s) 309
HaeIII GGCC 2 cut(s) 221, 345
Hin1II CATG 1 cut(s) 209
HincII GTYRAC 1 cut(s) 115
HindII GTYRAC 1 cut(s) 115
HinfI GANTC 3 cut(s) 94, 120, 236
HphI GGTGA 1 cut(s) 187
Hpy166II GTNNAC 2 cut(s) 115, 334
Hpy188I TCNGA 2 cut(s) 167, 268
Hpy188III TCNNGA 1 cut(s) 158
Hpy8I GTNNAC 2 cut(s) 115, 334
HpyCH4III ACNGT 2 cut(s) 9, 338
HpyCH4IV ACGT 1 cut(s) 349
HpyCH4V TGCA 1 cut(s) 55
HpyF10VI GCNNNNNNNGC 1 cut(s) 351
HpyF3I CTNAG 2 cut(s) 143, 238
HpySE526I ACGT 1 cut(s) 349
Hsp92II CATG 1 cut(s) 209
Kzo9I GATC 2 cut(s) 167, 268
LpnPI CCDG 2 cut(s) 143, 312
MaeI CTAG 1 cut(s) 309
MaeII ACGT 1 cut(s) 349
MaeIII GTNAC 1 cut(s) 241
MalI GATC 2 cut(s) 169, 270
MboI GATC 2 cut(s) 167, 268
MboII GAAGA 1 cut(s) 251
MluCI AATT 2 cut(s) 73, 223
MlyI GAGTC 3 cut(s) 88, 129, 230
MnlI CCTC 6 cut(s) 12, 75, 81, 138, 211, 335
MseI TTAA 1 cut(s) 201
MwoI GCNNNNNNNGC 1 cut(s) 351
NdeII GATC 2 cut(s) 167, 268
NlaIII CATG 1 cut(s) 209
NmuCI GTSAC 1 cut(s) 241
NspI RCATGY 1 cut(s) 209
PaqCI CACCTGC 1 cut(s) 307
PciI ACATGT 1 cut(s) 205
PflFI GACNNNGTC 1 cut(s) 239
PleI GAGTC 3 cut(s) 88, 128, 230
PpsI GAGTC 3 cut(s) 88, 128, 230
PscI ACATGT 1 cut(s) 205
Psp1406I AACGTT 1 cut(s) 349
PsyI GACNNNGTC 1 cut(s) 239
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
SaqAI TTAA 1 cut(s) 201
Sau3AI GATC 2 cut(s) 167, 268
SchI GAGTC 3 cut(s) 88, 129, 230
SetI ASST 7 cut(s) 86, 112, 136, 200, 301, 316, 352
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
Sse9I AATT 2 cut(s) 73, 223
SsiI CCGC 1 cut(s) 302
SspMI CTAG 1 cut(s) 309
StyI CCWWGG 1 cut(s) 134
TaaI ACNGT 2 cut(s) 9, 338
TaiI ACGT 1 cut(s) 352
TasI AATT 2 cut(s) 73, 223
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TscAI CASTG 1 cut(s) 57
TseFI GTSAC 1 cut(s) 241
Tsp45I GTSAC 1 cut(s) 241
TspDTI ATGAA 1 cut(s) 251
TspGWI ACGGA 1 cut(s) 132
TspRI CASTG 1 cut(s) 57
Tth111I GACNNNGTC 1 cut(s) 239
XceI RCATGY 1 cut(s) 209
XspI CTAG 1 cut(s) 309
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.