Rroxscaffold_3G00241750

Reverse transcriptase-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
33994789 .. 33998234
3446 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00241750.1

Sequence Viewer

Length: 270 bp
ATGGAACCCTTCATAAGACATCTAAATTGTCTGGCCAGTAATCATAGATCTCAGTTTGCTGCAGGAGGTTTTGTAATTAGGGGATTCCTTTGGAATACCTCTGGTTGCAGTAGCTCGACAGGTGGGAAGACTACAATTCTAGTTGTGGAAGCTACTGCCCTTCGAAATAGGCTGGAGTATGCTAAAGCGAAACGCTACAGGCGAATTGAGGTGGAAGGAGATTCAAAGCTCGTGATAGATGCTATAAGAGGAGCTACCACATCACCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

9.77

Weight (kDa)

10.02

Isoelectric Point (pI)

56.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 14 - 86 8.5e-09 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 33
AgsI TTSAA 1 cut(s) 225
AluBI AGCT 4 cut(s) 114, 152, 229, 254
AluI AGCT 4 cut(s) 114, 152, 229, 254
AoxI GGCC 1 cut(s) 33
ApeKI GCWGC 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 255
AsuII TTCGAA 1 cut(s) 163
BalI TGGCCA 1 cut(s) 35
BauI CACGAG 1 cut(s) 230
BbsI GAAGAC 1 cut(s) 134
BbvI GCAGC 1 cut(s) 46
BfaI CTAG 1 cut(s) 140
BfmI CTRYAG 2 cut(s) 60, 196
BglII AGATCT 1 cut(s) 47
BisI GCNGC 1 cut(s) 60
BlsI GCNGC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 1 cut(s) 229
BpiI GAAGAC 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 194
Bpu14I TTCGAA 1 cut(s) 163
BsaXI ACNNNNNCTCC 2 cut(s) 57, 87
Bse1I ACTGG 1 cut(s) 36
BseMII CTCAG 1 cut(s) 65
BseNI ACTGG 1 cut(s) 36
BseRI GAGGAG 1 cut(s) 264
BseXI GCAGC 1 cut(s) 46
BshFI GGCC 1 cut(s) 35
BsnI GGCC 1 cut(s) 35
Bsp119I TTCGAA 1 cut(s) 163
Bsp143I GATC 1 cut(s) 47
BspANI GGCC 1 cut(s) 35
BspCNI CTCAG 1 cut(s) 64
BspLI GGNNCC 1 cut(s) 6
BspMAI CTGCAG 1 cut(s) 64
BspT104I TTCGAA 1 cut(s) 163
BsrI ACTGG 1 cut(s) 36
BssMI GATC 1 cut(s) 47
BssSI CACGAG 1 cut(s) 230
Bst2BI CACGAG 1 cut(s) 230
BstBI TTCGAA 1 cut(s) 163
BstDEI CTNAG 1 cut(s) 51
BstKTI GATC 1 cut(s) 50
BstMBI GATC 1 cut(s) 47
BstSFI CTRYAG 2 cut(s) 60, 196
BstV1I GCAGC 1 cut(s) 46
BstV2I GAAGAC 1 cut(s) 134
BstX2I RGATCY 1 cut(s) 47
BstYI RGATCY 1 cut(s) 47
BsuRI GGCC 1 cut(s) 35
CviJI RGCY 6 cut(s) 35, 114, 152, 172, 229, 254
CviKI_1 RGCY 6 cut(s) 35, 114, 152, 172, 229, 254
DdeI CTNAG 1 cut(s) 51
DpnI GATC 1 cut(s) 49
DpnII GATC 1 cut(s) 47
EaeI YGGCCR 1 cut(s) 33
FaiI YATR 5 cut(s) 14, 45, 180, 245, 268
Fnu4HI GCNGC 1 cut(s) 60
Fsp4HI GCNGC 1 cut(s) 60
FspBI CTAG 1 cut(s) 140
GluI GCNGC 1 cut(s) 60
GsuI CTGGAG 1 cut(s) 194
HaeIII GGCC 1 cut(s) 35
HinfI GANTC 2 cut(s) 84, 221
HphI GGTGA 1 cut(s) 255
Hpy188III TCNNGA 1 cut(s) 232
HpyAV CCTTC 3 cut(s) 19, 170, 209
HpyCH4V TGCA 2 cut(s) 62, 108
HpyF3I CTNAG 1 cut(s) 51
Kzo9I GATC 1 cut(s) 47
LmnI GCTCC 1 cut(s) 251
LpnPI CCDG 7 cut(s) 17, 48, 49, 87, 105, 158, 184
Lsp1109I GCAGC 1 cut(s) 46
LweI GCATC 1 cut(s) 229
MaeI CTAG 1 cut(s) 140
MalI GATC 1 cut(s) 49
MboI GATC 1 cut(s) 47
MboII GAAGA 1 cut(s) 139
MflI RGATCY 1 cut(s) 47
MlsI TGGCCA 1 cut(s) 35
MluCI AATT 4 cut(s) 25, 75, 135, 204
MluNI TGGCCA 1 cut(s) 35
MnlI CCTC 4 cut(s) 59, 109, 202, 242
Mox20I TGGCCA 1 cut(s) 35
MscI TGGCCA 1 cut(s) 35
Msp20I TGGCCA 1 cut(s) 35
NdeII GATC 1 cut(s) 47
NlaIV GGNNCC 1 cut(s) 6
NspV TTCGAA 1 cut(s) 163
PcsI WCGNNNNNNNCGW 1 cut(s) 199
PfeI GAWTC 2 cut(s) 84, 221
PkrI GCNGC 1 cut(s) 61
PspN4I GGNNCC 1 cut(s) 6
PstI CTGCAG 1 cut(s) 64
PsuI RGATCY 1 cut(s) 47
SatI GCNGC 1 cut(s) 60
Sau3AI GATC 1 cut(s) 47
SetI ASST 8 cut(s) 70, 101, 116, 124, 154, 213, 231, 256
SfaNI GCATC 1 cut(s) 229
SfcI CTRYAG 2 cut(s) 60, 196
SfuI TTCGAA 1 cut(s) 163
Sse9I AATT 4 cut(s) 25, 75, 135, 204
SspMI CTAG 1 cut(s) 140
TaqI TCGA 2 cut(s) 116, 163
TasI AATT 4 cut(s) 25, 75, 135, 204
TfiI GAWTC 2 cut(s) 84, 221
TseI GCWGC 1 cut(s) 59
XspI CTAG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.