FvH4_5g35301

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Reverse (-)
25857872 .. 25858257
386 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g35301.t1

Sequence Viewer

Length: 228 bp
ATGCCCTACAAATTGATATGCAAAGTTGCCTTCAACTCTGGTGTTGCTAGTGTTCCCCTTGCCGAAGCTCTTGCGCTAAGACATAGTCTAGTATGCACTAAAGAGAAAGGCTTGTCAAAGATTGAAGTAGAAGGTGATTCCAAGCTCGTCATTGACATTGCGAATGGAGTTTGTGATCCCCCTTGGAGGCATATGAAGATCTTCCAAGATATCAAGTCATTGATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.25

Weight (kDa)

8.52

Isoelectric Point (pI)

36.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 13 - 59 4.5e-07 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 170
AfiI CCNNNNNNNGG 1 cut(s) 186
AgsI TTSAA 2 cut(s) 34, 125
AluBI AGCT 2 cut(s) 68, 145
AluI AGCT 2 cut(s) 68, 145
AlwI GGATC 1 cut(s) 170
Asp700I GAANNNNTTC 1 cut(s) 200
AspLEI GCGC 1 cut(s) 76
AsuHPI GGTGA 1 cut(s) 146
BcgI CGANNNNNNTGC 2 cut(s) 53, 87
BfaI CTAG 2 cut(s) 48, 89
BglII AGATCT 1 cut(s) 198
BsaJI CCNNGG 1 cut(s) 182
Bsc4I CCNNNNNNNGG 1 cut(s) 186
Bse3DI GCAATG 1 cut(s) 156
BseDI CCNNGG 1 cut(s) 182
BseLI CCNNNNNNNGG 1 cut(s) 186
BseMI GCAATG 1 cut(s) 156
BslI CCNNNNNNNGG 1 cut(s) 186
Bsp143I GATC 2 cut(s) 175, 198
BspPI GGATC 1 cut(s) 170
BsrDI GCAATG 1 cut(s) 156
BssECI CCNNGG 1 cut(s) 182
BssMI GATC 2 cut(s) 175, 198
BssT1I CCWWGG 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 77
BstHHI GCGC 1 cut(s) 76
BstKTI GATC 2 cut(s) 178, 201
BstMBI GATC 2 cut(s) 175, 198
BstX2I RGATCY 1 cut(s) 198
BstYI RGATCY 1 cut(s) 198
CfoI GCGC 1 cut(s) 76
CviJI RGCY 3 cut(s) 68, 111, 145
CviKI_1 RGCY 3 cut(s) 68, 111, 145
DdeI CTNAG 1 cut(s) 77
DpnI GATC 2 cut(s) 177, 200
DpnII GATC 2 cut(s) 175, 198
Eco130I CCWWGG 1 cut(s) 182
Eco32I GATATC 1 cut(s) 211
EcoRV GATATC 1 cut(s) 211
EcoT14I CCWWGG 1 cut(s) 182
ErhI CCWWGG 1 cut(s) 182
FaiI YATR 5 cut(s) 19, 84, 94, 192, 194
FauNDI CATATG 1 cut(s) 192
FspBI CTAG 2 cut(s) 48, 89
GlaI GCGC 1 cut(s) 75
HhaI GCGC 1 cut(s) 76
Hin6I GCGC 1 cut(s) 74
HinP1I GCGC 1 cut(s) 74
HinfI GANTC 1 cut(s) 137
HphI GGTGA 1 cut(s) 146
HpyAV CCTTC 2 cut(s) 40, 125
HpyCH4V TGCA 2 cut(s) 21, 96
HpyF3I CTNAG 1 cut(s) 77
HspAI GCGC 1 cut(s) 74
Kzo9I GATC 2 cut(s) 175, 198
LpnPI CCDG 1 cut(s) 24
MaeI CTAG 2 cut(s) 48, 89
MalI GATC 2 cut(s) 177, 200
MboI GATC 2 cut(s) 175, 198
MboII GAAGA 2 cut(s) 193, 208
MflI RGATCY 1 cut(s) 198
MluCI AATT 1 cut(s) 11
MnlI CCTC 1 cut(s) 180
MroXI GAANNNNTTC 1 cut(s) 200
NdeI CATATG 1 cut(s) 192
NdeII GATC 2 cut(s) 175, 198
PdmI GAANNNNTTC 1 cut(s) 200
PfeI GAWTC 1 cut(s) 137
PflFI GACNNNGTC 1 cut(s) 84
PsuI RGATCY 1 cut(s) 198
PsyI GACNNNGTC 1 cut(s) 84
Sau3AI GATC 2 cut(s) 175, 198
SetI ASST 3 cut(s) 70, 136, 147
Sse9I AATT 1 cut(s) 11
SspMI CTAG 2 cut(s) 48, 89
StyI CCWWGG 1 cut(s) 182
TasI AATT 1 cut(s) 11
TfiI GAWTC 1 cut(s) 137
TspDTI ATGAA 1 cut(s) 209
Tth111I GACNNNGTC 1 cut(s) 84
XmnI GAANNNNTTC 1 cut(s) 200
XspI CTAG 2 cut(s) 48, 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.