FvH4_5g30730

Lignin degradation and detoxification of lignin-derived products

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0000359
Physical Location & Seq
Reverse (-)
21638641 .. 21640442
1802 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g30730.t1

Sequence Viewer

Length: 714 bp
ATGAAGATTCCTATGAAAGAGACAGTGGATGTTGTTCTTCTTTTTCTTGATGTTACAAATGGGAAAACTCATCACCATAAGTTTGTGGTAAAGTCATCTTCTTATAGTCGACTATGTAGTAGTAAACACATCTTGACCGTGAATAGGAGATTCCCAGGGCCAACTTTGAAAGCTCACAGAGGGGATAACATGGCTATAGAAGTCCATAACAAGGCAAACTATAATATCACTCTTCATTGGGTGCTAGAGCATGGAGTTAGACAACTAAGAAATCCATGGTCGGATGGACCAGAGTACATCACACAATGCCCTATACAGCCTAGAAACAAGTACACTTACATATTTGAATTTACTACAGAAGAAGGAACAGTATGGTGGCATGCACATAATGGATGGGCAAGAGCAACAATTCATGGAGCCATTTTTGTTTATCCCAAACCTGGATCAAGCTATCCTTTTCTGAAACCTTACGCTGAGTTCTCGATCATACTAGGTGAATGGTGGAAGAGAGATGTCATGAAAATACCAAGAACTGCAAATCTAACAGGAAGAGAACCCATACTCTCAGATGCCTATACTATAAATGGAGAACTAGGCTTTCTATATTCATGCTCTGAAAAAGGCATACAATCAAGCTTCAATTATTGTTTGAATAAAGAAGCTAATGTGAATTGTAGTTACTTCAACATAATATTCCATTGCATGGACCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0008150 GO:0008152 GO:0016491 GO:0016722 GO:0055114
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu-oxidase Cu-oxidase_2 Cu-oxidase_3

Protein Analysis

238

Amino Acids

27.42

Weight (kDa)

8.95

Isoelectric Point (pI)

39.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase_3 PF07732 30 - 146 8.5e-37 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000359)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G48100
fragaria_vesca FvH4_1g24380 FvH4_2g05800 FvH4_5g30730
malus_domestica MD01G1234900.v1.1 MD01G1235100.v1.1 MD01G1235200.v1.1 MD07G1307400.v1.1 MD07G1308000.v1.1 MD10G1042300.v1.1 MD10G1042400.v1.1 MD10G1042500.v1.1 MD10G1042700.v1.1
prunus_persica Prupe.2G325200_v2.0.a1 Prupe.6G242000_v2.0.a1 Prupe.8G046800_v2.0.a1 Prupe.8G046900_v2.0.a1 Prupe.8G046900_v2.0.a1 Prupe.8G046900_v2.0.a1
pyrus_communis pycom01g24320 pycom01g24330 pycom07g28020 pycom10g02950 pycom17g03690
rosa_chinensis RchiOBHm_Chr1g0384031 RchiOBHm_Chr2g0120941 RchiOBHm_Chr2g0120971 RchiOBHm_Chr2g0121051 RchiOBHm_Chr2g0121181 RchiOBHm_Chr2g0121211 RchiOBHm_Chr3g0473931 RchiOBHm_Chr3g0473941 RchiOBHm_Chr6g0257941 RchiOBHm_Chr6g0284781
rosa_laevigata RLG00000008541 RLG00000014737 RLG00000018604 RLG00000018607 RLG00000018608 RLG00000018610 RLG00000018611 RLG00000018613 RLG00000023967 RLG00000023970 RLG00000026078 RLG00000035183
rosa_multiflora Rmu_sc0000079.1_g000043 Rmu_sc0000079.1_g000062 Rmu_sc0000079.1_g000069 Rmu_sc0000621.1_g000019 Rmu_sc0000621.1_g000025 Rmu_sc0000621.1_g000041 Rmu_sc0000652.1_g000018 Rmu_sc0002414.1_g000030 Rmu_sc0002414.1_g000033 Rmu_sc0002843.1_g000016 Rmu_sc0005137.1_g000035 Rmu_sc0005139.1_g000021
rosa_roxburghii Rroxscaffold_2G00122530 Rroxscaffold_2G00122570 Rroxscaffold_2G00122580 Rroxscaffold_2G00122650 Rroxscaffold_4G00277080 Rroxscaffold_6G00407610 Rroxscaffold_6G00407620 Rroxscaffold_7G00209050
rosa_rugosa Rorug01G0444300 Rorug02G0232700 Rorug02G0232700 Rorug02G0232900 Rorug03G0137100 Rorug05G0565600 Rorug05G0566500
rosa_samantha Rh1BG427300 Rh1CG440100 Rh2CG278100 Rh2CG278200 Rh2CG278700 Rh2CG278800 Rh2CG279100 Rh2DG314200 Rh2DG314300 Rh2DG314600 Rh3AG187200 Rh3DG211700 Rh3DG211800 Rh5AG356600 Rh6BG078000 Rh6BG078700 Rh6CG073300 Rh6DG070300 Rh6DG190200 Rh6DG274700 Rh7BG365900
rosa_wichuraiana Rw0G018400 Rw1G040270 Rw2G023160 Rw2G023170 Rw2G023190 Rw2G023200 Rw2G023220 Rw2G023230 Rw3G017140 Rw3G017150 Rw4G012840 Rw6G007580

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 703
AccI GTMKAC 1 cut(s) 109
AclWI GGATC 1 cut(s) 451
AcsI RAATTY 1 cut(s) 347
AfaI GTAC 2 cut(s) 296, 332
AfiI CCNNNNNNNGG 4 cut(s) 144, 211, 440, 703
AgsI TTSAA 5 cut(s) 169, 347, 640, 652, 685
AjnI CCWGG 2 cut(s) 154, 439
AluBI AGCT 4 cut(s) 173, 450, 636, 662
AluI AGCT 4 cut(s) 173, 450, 636, 662
Alw26I GTCTC 1 cut(s) 14
AlwI GGATC 1 cut(s) 451
AoxI GGCC 1 cut(s) 158
ApoI RAATTY 1 cut(s) 347
AspS9I GGNCC 3 cut(s) 158, 287, 706
AsuHPI GGTGA 2 cut(s) 65, 506
AvaII GGWCC 2 cut(s) 287, 706
BccI CCATC 2 cut(s) 278, 387
BciT130I CCWGG 2 cut(s) 156, 441
BcoDI GTCTC 1 cut(s) 14
BfaI CTAG 4 cut(s) 245, 321, 491, 593
BfmI CTRYAG 2 cut(s) 195, 354
Bme1390I CCNGG 2 cut(s) 156, 441
Bme18I GGWCC 2 cut(s) 287, 706
BmgT120I GGNCC 3 cut(s) 158, 287, 706
BmiI GGNNCC 1 cut(s) 418
BmrFI CCNGG 2 cut(s) 156, 441
BmsI GCATC 1 cut(s) 559
BsaJI CCNNGG 3 cut(s) 154, 155, 275
Bsc4I CCNNNNNNNGG 4 cut(s) 144, 211, 440, 703
Bse3DI GCAATG 1 cut(s) 697
BseBI CCWGG 2 cut(s) 156, 441
BseDI CCNNGG 3 cut(s) 154, 155, 275
BseGI GGATG 3 cut(s) 34, 289, 398
BseLI CCNNNNNNNGG 4 cut(s) 144, 211, 440, 703
BseMI GCAATG 1 cut(s) 697
BseMII CTCAG 2 cut(s) 465, 579
BshFI GGCC 1 cut(s) 160
BslI CCNNNNNNNGG 4 cut(s) 144, 211, 440, 703
BsmAI GTCTC 1 cut(s) 14
BsnI GGCC 1 cut(s) 160
Bsp143I GATC 2 cut(s) 443, 483
Bsp19I CCATGG 1 cut(s) 275
BspANI GGCC 1 cut(s) 160
BspCNI CTCAG 2 cut(s) 466, 578
BspHI TCATGA 1 cut(s) 516
BspLI GGNNCC 1 cut(s) 418
BspPI GGATC 1 cut(s) 451
BsrDI GCAATG 1 cut(s) 697
BssECI CCNNGG 3 cut(s) 154, 155, 275
BssMI GATC 2 cut(s) 443, 483
BssT1I CCWWGG 1 cut(s) 275
Bst2UI CCWGG 2 cut(s) 156, 441
Bst4CI ACNGT 3 cut(s) 25, 139, 370
Bst6I CTCTTC 3 cut(s) 237, 500, 544
BstC8I GCNNGC 1 cut(s) 381
BstDEI CTNAG 3 cut(s) 266, 474, 565
BstDSI CCRYGG 1 cut(s) 275
BstF5I GGATG 3 cut(s) 34, 289, 398
BstKTI GATC 2 cut(s) 446, 486
BstMAI GTCTC 1 cut(s) 14
BstMBI GATC 2 cut(s) 443, 483
BstNI CCWGG 2 cut(s) 156, 441
BstNSI RCATGY 1 cut(s) 383
BstSCI CCNGG 2 cut(s) 154, 439
BstSFI CTRYAG 2 cut(s) 195, 354
BsuRI GGCC 1 cut(s) 160
BtgI CCRYGG 1 cut(s) 275
BtsCI GGATG 3 cut(s) 34, 289, 398
BtsIMutI CAGTG 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 381
CciI TCATGA 1 cut(s) 516
Cfr13I GGNCC 3 cut(s) 158, 287, 706
Csp6I GTAC 2 cut(s) 295, 331
CviAII CATG 8 cut(s) 190, 251, 276, 380, 413, 517, 609, 703
CviJI RGCY 9 cut(s) 160, 173, 194, 319, 419, 450, 597, 636, 662
CviKI_1 RGCY 9 cut(s) 160, 173, 194, 319, 419, 450, 597, 636, 662
CviQI GTAC 2 cut(s) 295, 331
DdeI CTNAG 3 cut(s) 266, 474, 565
DpnI GATC 2 cut(s) 445, 485
DpnII GATC 2 cut(s) 443, 483
Eam1104I CTCTTC 3 cut(s) 237, 500, 544
EarI CTCTTC 3 cut(s) 237, 500, 544
Eco130I CCWWGG 1 cut(s) 275
Eco47I GGWCC 2 cut(s) 287, 706
EcoRII CCWGG 2 cut(s) 154, 439
EcoT14I CCWWGG 1 cut(s) 275
ErhI CCWWGG 1 cut(s) 275
FaeI CATG 8 cut(s) 193, 254, 279, 383, 416, 520, 612, 706
FalI AAGNNNNNCTT 2 cut(s) 439, 471
FatI CATG 8 cut(s) 189, 250, 275, 379, 412, 516, 608, 702
FblI GTMKAC 1 cut(s) 109
FokI GGATG 3 cut(s) 41, 296, 405
FspBI CTAG 4 cut(s) 245, 321, 491, 593
HaeIII GGCC 1 cut(s) 160
Hin1II CATG 8 cut(s) 193, 254, 279, 383, 416, 520, 612, 706
HincII GTYRAC 1 cut(s) 110
HindII GTYRAC 1 cut(s) 110
HindIII AAGCTT 1 cut(s) 634
HinfI GANTC 2 cut(s) 7, 150
HphI GGTGA 2 cut(s) 65, 506
Hpy166II GTNNAC 3 cut(s) 110, 125, 333
Hpy188I TCNGA 4 cut(s) 283, 462, 568, 616
Hpy188III TCNNGA 4 cut(s) 47, 133, 481, 517
Hpy8I GTNNAC 3 cut(s) 110, 125, 333
HpyAV CCTTC 1 cut(s) 356
HpyCH4III ACNGT 3 cut(s) 25, 139, 370
HpyCH4V TGCA 3 cut(s) 383, 536, 702
HpyF3I CTNAG 3 cut(s) 266, 474, 565
Hsp92II CATG 8 cut(s) 193, 254, 279, 383, 416, 520, 612, 706
Kzo9I GATC 2 cut(s) 443, 483
LmnI GCTCC 1 cut(s) 416
LpnPI CCDG 6 cut(s) 141, 168, 303, 426, 453, 531
LweI GCATC 1 cut(s) 559
MaeI CTAG 4 cut(s) 245, 321, 491, 593
MaeIII GTNAC 2 cut(s) 52, 677
MalI GATC 2 cut(s) 445, 485
MboI GATC 2 cut(s) 443, 483
MboII GAAGA 7 cut(s) 16, 29, 90, 224, 371, 517, 561
MluCI AATT 4 cut(s) 347, 408, 640, 670
MmeI TCCRAC 1 cut(s) 261
MnlI CCTC 1 cut(s) 173
MspR9I CCNGG 2 cut(s) 156, 441
MvaI CCWGG 2 cut(s) 156, 441
NcoI CCATGG 1 cut(s) 275
NdeII GATC 2 cut(s) 443, 483
NlaIII CATG 8 cut(s) 193, 254, 279, 383, 416, 520, 612, 706
NlaIV GGNNCC 1 cut(s) 418
NspI RCATGY 1 cut(s) 383
PaeI GCATGC 1 cut(s) 383
PagI TCATGA 1 cut(s) 516
PasI CCCWGGG 1 cut(s) 155
PfeI GAWTC 2 cut(s) 7, 150
PflMI CCANNNNNTGG 1 cut(s) 703
Psp6I CCWGG 2 cut(s) 154, 439
PspGI CCWGG 2 cut(s) 154, 439
PspN4I GGNNCC 1 cut(s) 418
PspPI GGNCC 3 cut(s) 158, 287, 706
RsaI GTAC 2 cut(s) 296, 332
RsaNI GTAC 2 cut(s) 295, 331
SalI GTCGAC 1 cut(s) 108
Sau3AI GATC 2 cut(s) 443, 483
Sau96I GGNCC 3 cut(s) 158, 287, 706
ScrFI CCNGG 2 cut(s) 156, 441
SetI ASST 8 cut(s) 175, 442, 452, 469, 496, 638, 664, 711
SfaNI GCATC 1 cut(s) 559
SfcI CTRYAG 2 cut(s) 195, 354
SinI GGWCC 2 cut(s) 287, 706
SphI GCATGC 1 cut(s) 383
Sse9I AATT 4 cut(s) 347, 408, 640, 670
SspI AATATT 1 cut(s) 693
SspMI CTAG 4 cut(s) 245, 321, 491, 593
StyD4I CCNGG 2 cut(s) 154, 439
StyI CCWWGG 1 cut(s) 275
TaaI ACNGT 3 cut(s) 25, 139, 370
TaqI TCGA 2 cut(s) 109, 482
TasI AATT 4 cut(s) 347, 408, 640, 670
TatI WGTACW 2 cut(s) 294, 330
TfiI GAWTC 2 cut(s) 7, 150
TscAI CASTG 1 cut(s) 30
TspDTI ATGAA 6 cut(s) 17, 29, 224, 401, 533, 597
TspRI CASTG 1 cut(s) 30
Van91I CCANNNNNTGG 1 cut(s) 703
VpaK11BI GGWCC 2 cut(s) 287, 706
XapI RAATTY 1 cut(s) 347
XceI RCATGY 1 cut(s) 383
XmiI GTMKAC 1 cut(s) 109
XspI CTAG 4 cut(s) 245, 321, 491, 593
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.