Prupe.2G179900_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
OG0000574
Physical Location & Seq
Forward (+)
22343078 .. 22343512
435 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G179900.1

Sequence Viewer

Length: 435 bp
ATGGCCGATCTTCACGATCAATGGCGCCAATCCATAATAATCTTGCATGAACACAATACCTTTAAAATCACGTTTAATATTCTCCTAATCAATCTTGCCAAACAAGTTGCTTCCACTTCCACTTCCACTCATGCTATTCTTGCTTTTGTCGTTCCCATTCTCCTCACCTTTGTTGAAATCAAATTCCCAGGATCAATAATGTCAGCTACTCCATTTGAAACCCATCCAACCCTAATCCTAGTTTCCATAGCCAGCTTAATTGCTTATTGCTTGGCTGTTGGGGCTAGGTTAAGATTCCCTACTTACGCTCGTACCTACTCTCGCTTCGCCATGAGGTTTTTTGGTCTGCTCTCAGTCGCCTCACTGCTCTCAGTTTTGCTTCCAGGCTATTGGCACCCTGTCCCGTTCTTGATTTTCATCTTATATTTCATGGGC
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

145

Amino Acids

16.35

Weight (kDa)

9.58

Isoelectric Point (pI)

46.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 24, 393
AclWI GGATC 1 cut(s) 199
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 182
AcyI GRCGYC 1 cut(s) 25
AfaI GTAC 1 cut(s) 313
AgsI TTSAA 2 cut(s) 176, 218
AjnI CCWGG 2 cut(s) 187, 382
AluBI AGCT 2 cut(s) 206, 255
AluI AGCT 2 cut(s) 206, 255
AlwI GGATC 1 cut(s) 199
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 182
AspLEI GCGC 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 157
BaeI ACNNNNGTAYC 2 cut(s) 295, 328
BanI GGYRCC 2 cut(s) 24, 393
BccI CCATC 1 cut(s) 231
BciT130I CCWGG 2 cut(s) 189, 384
BfaI CTAG 2 cut(s) 239, 285
BfoI RGCGCY 1 cut(s) 28
Bme1390I CCNGG 2 cut(s) 189, 384
BmiI GGNNCC 2 cut(s) 26, 395
BmrFI CCNGG 2 cut(s) 189, 384
BsaBI GATNNNNATC 1 cut(s) 416
BsaHI GRCGYC 1 cut(s) 25
BsaJI CCNNGG 1 cut(s) 187
Bse8I GATNNNNATC 1 cut(s) 416
BseBI CCWGG 2 cut(s) 189, 384
BseDI CCNNGG 1 cut(s) 187
BseGI GGATG 1 cut(s) 223
BseJI GATNNNNATC 1 cut(s) 416
BseMII CTCAG 2 cut(s) 366, 384
BseRI GAGGAG 1 cut(s) 152
BshFI GGCC 1 cut(s) 5
BshNI GGYRCC 2 cut(s) 24, 393
BslFI GGGAC 1 cut(s) 386
BsmFI GGGAC 1 cut(s) 386
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 3 cut(s) 7, 16, 191
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 2 cut(s) 365, 383
BspLI GGNNCC 2 cut(s) 26, 395
BspPI GGATC 1 cut(s) 199
BspT107I GGYRCC 2 cut(s) 24, 393
BssECI CCNNGG 1 cut(s) 187
BssMI GATC 3 cut(s) 7, 16, 191
BssNI GRCGYC 1 cut(s) 25
Bst2UI CCWGG 2 cut(s) 189, 384
BstACI GRCGYC 1 cut(s) 25
BstC8I GCNNGC 1 cut(s) 253
BstDEI CTNAG 2 cut(s) 352, 370
BstF5I GGATG 1 cut(s) 223
BstH2I RGCGCY 1 cut(s) 28
BstHHI GCGC 1 cut(s) 27
BstKTI GATC 3 cut(s) 10, 19, 194
BstMBI GATC 3 cut(s) 7, 16, 191
BstMWI GCNNNNNNNGC 2 cut(s) 140, 281
BstNI CCWGG 2 cut(s) 189, 384
BstSCI CCNGG 2 cut(s) 187, 382
BstXI CCANNNNNNTGG 1 cut(s) 390
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 223
BtsI GCAGTG 1 cut(s) 362
BtsIMutI CAGTG 1 cut(s) 362
Cac8I GCNNGC 1 cut(s) 253
CfoI GCGC 1 cut(s) 27
Csp6I GTAC 1 cut(s) 312
CviAII CATG 4 cut(s) 47, 131, 331, 430
CviJI RGCY 7 cut(s) 5, 206, 251, 255, 275, 284, 387
CviKI_1 RGCY 7 cut(s) 5, 206, 251, 255, 275, 284, 387
CviQI GTAC 1 cut(s) 312
DdeI CTNAG 2 cut(s) 352, 370
DinI GGCGCC 1 cut(s) 26
DpnI GATC 3 cut(s) 9, 18, 193
DpnII GATC 3 cut(s) 7, 16, 191
DraI TTTAAA 1 cut(s) 64
EaeI YGGCCR 1 cut(s) 3
EcoRII CCWGG 2 cut(s) 187, 382
EgeI GGCGCC 1 cut(s) 26
EheI GGCGCC 1 cut(s) 26
FaeI CATG 4 cut(s) 50, 134, 334, 433
FaiI YATR 7 cut(s) 35, 48, 132, 248, 332, 424, 431
FaqI GGGAC 1 cut(s) 386
FatI CATG 4 cut(s) 46, 130, 330, 429
FokI GGATG 1 cut(s) 210
FspBI CTAG 2 cut(s) 239, 285
GlaI GCGC 1 cut(s) 26
HaeII RGCGCY 1 cut(s) 28
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 27
Hin1I GRCGYC 1 cut(s) 25
Hin1II CATG 4 cut(s) 50, 134, 334, 433
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HinfI GANTC 1 cut(s) 294
HphI GGTGA 1 cut(s) 157
Hpy188III TCNNGA 2 cut(s) 14, 409
HpyCH4IV ACGT 1 cut(s) 71
HpyCH4V TGCA 1 cut(s) 46
HpyF10VI GCNNNNNNNGC 2 cut(s) 140, 281
HpyF3I CTNAG 2 cut(s) 352, 370
HpySE526I ACGT 1 cut(s) 71
Hsp92I GRCGYC 1 cut(s) 25
Hsp92II CATG 4 cut(s) 50, 134, 334, 433
HspAI GCGC 1 cut(s) 25
KasI GGCGCC 1 cut(s) 24
Kzo9I GATC 3 cut(s) 7, 16, 191
LpnPI CCDG 6 cut(s) 174, 201, 265, 369, 396, 411
MaeI CTAG 2 cut(s) 239, 285
MaeII ACGT 1 cut(s) 71
MalI GATC 3 cut(s) 9, 18, 193
MboI GATC 3 cut(s) 7, 16, 191
MluCI AATT 2 cut(s) 182, 258
Mly113I GGCGCC 1 cut(s) 25
MmeI TCCRAC 1 cut(s) 251
MnlI CCTC 3 cut(s) 173, 327, 370
MseI TTAA 4 cut(s) 63, 75, 257, 290
MspR9I CCNGG 2 cut(s) 189, 384
MvaI CCWGG 2 cut(s) 189, 384
MwoI GCNNNNNNNGC 2 cut(s) 140, 281
NarI GGCGCC 1 cut(s) 25
NdeII GATC 3 cut(s) 7, 16, 191
NlaIII CATG 4 cut(s) 50, 134, 334, 433
NlaIV GGNNCC 2 cut(s) 26, 395
PfeI GAWTC 1 cut(s) 294
PluTI GGCGCC 1 cut(s) 28
Psp6I CCWGG 2 cut(s) 187, 382
PspGI CCWGG 2 cut(s) 187, 382
PspN4I GGNNCC 2 cut(s) 26, 395
RsaI GTAC 1 cut(s) 313
RsaNI GTAC 1 cut(s) 312
SaqAI TTAA 4 cut(s) 63, 75, 257, 290
Sau3AI GATC 3 cut(s) 7, 16, 191
ScrFI CCNGG 2 cut(s) 189, 384
SetI ASST 8 cut(s) 62, 74, 170, 208, 257, 290, 317, 338
SfoI GGCGCC 1 cut(s) 26
Sse9I AATT 2 cut(s) 182, 258
SspDI GGCGCC 1 cut(s) 24
SspI AATATT 1 cut(s) 79
SspMI CTAG 2 cut(s) 239, 285
StyD4I CCNGG 2 cut(s) 187, 382
TaiI ACGT 1 cut(s) 74
TasI AATT 2 cut(s) 182, 258
TfiI GAWTC 1 cut(s) 294
Tru1I TTAA 4 cut(s) 63, 75, 257, 290
Tru9I TTAA 4 cut(s) 63, 75, 257, 290
TscAI CASTG 1 cut(s) 369
TspDTI ATGAA 3 cut(s) 63, 406, 418
TspRI CASTG 1 cut(s) 369
XapI RAATTY 1 cut(s) 182
XspI CTAG 2 cut(s) 239, 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.