Rh1CG258500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
52317398 .. 52326215
8818 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG258500.1

Sequence Viewer

Length: 300 bp
ATGGCTGAACTTCAGCATGAAATGCGCCAAACCCTAATCTTACACGAATATAATTCCTTTACTGTAACCTTCAACATCTTTCTAATCAATCTCTCAGCTTCCACTTCCAGTCATGCCATTCTCGCTTTCATCGTCCCCATACTCGTCGCCTTTATTCAAATCAAGTTCCCAGGAATTTCAGTACTGTCTTCTCCATTCGAAACACATCGTAACACTACAGTTGTTGCGATTGCAAGCTTACTTGCATATTGCTTGATTGTTGGGGTTAGGAAGCTGAGCTTTCCTGATTGTGTGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.0

Weight (kDa)

6.38

Isoelectric Point (pI)

36.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 174
AfaI GTAC 1 cut(s) 183
AgsI TTSAA 2 cut(s) 73, 158
AjnI CCWGG 1 cut(s) 169
AluBI AGCT 4 cut(s) 98, 237, 274, 279
AluI AGCT 4 cut(s) 98, 237, 274, 279
ApoI RAATTY 1 cut(s) 174
AspLEI GCGC 1 cut(s) 27
AsuII TTCGAA 1 cut(s) 198
BbsI GAAGAC 1 cut(s) 180
BciT130I CCWGG 1 cut(s) 171
BfmI CTRYAG 1 cut(s) 216
BlpI GCTNAGC 1 cut(s) 275
BmcAI AGTACT 1 cut(s) 183
Bme1390I CCNGG 1 cut(s) 171
BmrFI CCNGG 1 cut(s) 171
BpiI GAAGAC 1 cut(s) 180
Bpu1102I GCTNAGC 1 cut(s) 275
Bpu14I TTCGAA 1 cut(s) 198
BsaJI CCNNGG 1 cut(s) 169
Bse1I ACTGG 1 cut(s) 108
BseBI CCWGG 1 cut(s) 171
BseDI CCNNGG 1 cut(s) 169
BseMII CTCAG 2 cut(s) 108, 266
BseNI ACTGG 1 cut(s) 108
BslFI GGGAC 1 cut(s) 119
BsmFI GGGAC 1 cut(s) 119
Bsp119I TTCGAA 1 cut(s) 198
Bsp1720I GCTNAGC 1 cut(s) 275
BspCNI CTCAG 2 cut(s) 107, 267
BspT104I TTCGAA 1 cut(s) 198
BsrI ACTGG 1 cut(s) 108
BssECI CCNNGG 1 cut(s) 169
Bst2UI CCWGG 1 cut(s) 171
Bst4CI ACNGT 3 cut(s) 64, 186, 220
BstAPI GCANNNNNTGC 1 cut(s) 22
BstBI TTCGAA 1 cut(s) 198
BstC8I GCNNGC 1 cut(s) 235
BstDEI CTNAG 2 cut(s) 94, 275
BstHHI GCGC 1 cut(s) 27
BstMWI GCNNNNNNNGC 2 cut(s) 22, 122
BstNI CCWGG 1 cut(s) 171
BstSCI CCNGG 1 cut(s) 169
BstSFI CTRYAG 1 cut(s) 216
BstV2I GAAGAC 1 cut(s) 180
Cac8I GCNNGC 1 cut(s) 235
CfoI GCGC 1 cut(s) 27
Csp6I GTAC 1 cut(s) 182
CviAII CATG 2 cut(s) 17, 113
CviJI RGCY 5 cut(s) 5, 98, 237, 274, 279
CviKI_1 RGCY 5 cut(s) 5, 98, 237, 274, 279
CviQI GTAC 1 cut(s) 182
DdeI CTNAG 2 cut(s) 94, 275
EcoRII CCWGG 1 cut(s) 169
FaeI CATG 2 cut(s) 20, 116
FaiI YATR 5 cut(s) 18, 51, 114, 140, 247
FalI AAGNNNNNCTT 2 cut(s) 263, 295
FaqI GGGAC 1 cut(s) 119
FatI CATG 2 cut(s) 16, 112
GlaI GCGC 1 cut(s) 26
HhaI GCGC 1 cut(s) 27
Hin1II CATG 2 cut(s) 20, 116
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HindIII AAGCTT 1 cut(s) 235
Hpy188III TCNNGA 1 cut(s) 284
Hpy99I CGWCG 1 cut(s) 149
HpyAV CCTTC 1 cut(s) 79
HpyCH4III ACNGT 3 cut(s) 64, 186, 220
HpyCH4V TGCA 2 cut(s) 233, 245
HpyF10VI GCNNNNNNNGC 2 cut(s) 22, 122
HpyF3I CTNAG 2 cut(s) 94, 275
Hsp92II CATG 2 cut(s) 20, 116
HspAI GCGC 1 cut(s) 25
LpnPI CCDG 3 cut(s) 121, 156, 183
MaeIII GTNAC 2 cut(s) 64, 209
MboII GAAGA 1 cut(s) 180
MluCI AATT 2 cut(s) 52, 174
MseI TTAA 1 cut(s) 298
MspR9I CCNGG 1 cut(s) 171
MvaI CCWGG 1 cut(s) 171
MwoI GCNNNNNNNGC 2 cut(s) 22, 122
NlaIII CATG 2 cut(s) 20, 116
NspV TTCGAA 1 cut(s) 198
PcsI WCGNNNNNNNCGW 1 cut(s) 129
Psp6I CCWGG 1 cut(s) 169
PspGI CCWGG 1 cut(s) 169
RsaI GTAC 1 cut(s) 183
RsaNI GTAC 1 cut(s) 182
SaqAI TTAA 1 cut(s) 298
ScaI AGTACT 1 cut(s) 183
ScrFI CCNGG 1 cut(s) 171
SetI ASST 5 cut(s) 71, 100, 239, 276, 281
SfcI CTRYAG 1 cut(s) 216
SfuI TTCGAA 1 cut(s) 198
Sse9I AATT 2 cut(s) 52, 174
StyD4I CCNGG 1 cut(s) 169
TaaI ACNGT 3 cut(s) 64, 186, 220
TaqI TCGA 1 cut(s) 198
TasI AATT 2 cut(s) 52, 174
TatI WGTACW 1 cut(s) 181
Tru1I TTAA 1 cut(s) 298
Tru9I TTAA 1 cut(s) 298
TspDTI ATGAA 2 cut(s) 33, 118
XapI RAATTY 1 cut(s) 174
ZrmI AGTACT 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.