Rroxscaffold_4G00305310

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
25941214 .. 25944061
2848 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00305310.1

Sequence Viewer

Length: 393 bp
ATGGGAGTCATGCACTCCATCATTAACAACATTCAGTTCCAGAACTTTGGACAGATATTAATTCTGCCCGGAACTGCTTCCAGATATTCTTACAGGTATGATCATGTTCACGACGCCGTGGTGTTCATCATTCCGGTACTCCTGACCTTGGTCCAGATCAGATATCCGGCTGAAAATCTGTTCACAACACACCCCATCACCATCATCTTTGTTCAGTCTAGCTTACTTGGATATTGCTTGGTCTTAAGTACTTATAGGTCAAACTCAGAAATCATAAAAAAGATCGCCCAAAGAAACGCCAATCAGAAAAGAAGTACTGTATCTTACACTTCCGGTTCTTTTTGTTGCATTTCCTTGTCGTCCAGGCTCACTCCCTTGGATTTGGGCTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

130

Amino Acids

14.6

Weight (kDa)

9.37

Isoelectric Point (pI)

41.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 114
AfaI GTAC 3 cut(s) 138, 250, 316
AfiI CCNNNNNNNGG 1 cut(s) 148
AflII CTTAAG 1 cut(s) 244
AjnI CCWGG 1 cut(s) 362
AluBI AGCT 1 cut(s) 222
AluI AGCT 1 cut(s) 222
AseI ATTAAT 1 cut(s) 59
Asp700I GAANNNNTTC 1 cut(s) 76
AspS9I GGNCC 1 cut(s) 151
AsuC2I CCSGG 1 cut(s) 69
AsuHPI GGTGA 1 cut(s) 190
AvaII GGWCC 1 cut(s) 151
BanII GRGCYC 1 cut(s) 389
BccI CCATC 3 cut(s) 26, 203, 209
BceAI ACGGC 1 cut(s) 101
BciT130I CCWGG 1 cut(s) 364
BclI TGATCA 1 cut(s) 100
BcnI CCSGG 1 cut(s) 69
BfaI CTAG 1 cut(s) 219
BfrI CTTAAG 1 cut(s) 244
BmcAI AGTACT 2 cut(s) 250, 316
Bme1390I CCNGG 2 cut(s) 69, 364
Bme18I GGWCC 1 cut(s) 151
BmgT120I GGNCC 1 cut(s) 151
BmrFI CCNGG 2 cut(s) 69, 364
BoxI GACNNNNGTC 1 cut(s) 149
BpuMI CCSGG 1 cut(s) 69
BsaHI GRCGYC 1 cut(s) 114
BsaJI CCNNGG 3 cut(s) 117, 147, 375
BsaWI WCCGGW 2 cut(s) 133, 332
Bsc4I CCNNNNNNNGG 1 cut(s) 148
BseBI CCWGG 1 cut(s) 364
BseDI CCNNGG 3 cut(s) 117, 147, 375
BseLI CCNNNNNNNGG 1 cut(s) 148
BseMII CTCAG 1 cut(s) 279
BsiSI CCGG 4 cut(s) 69, 134, 167, 333
BslI CCNNNNNNNGG 1 cut(s) 148
Bsp1286I GDGCHC 1 cut(s) 389
Bsp143I GATC 3 cut(s) 100, 156, 282
BspCNI CTCAG 1 cut(s) 278
BspTI CTTAAG 1 cut(s) 244
BssECI CCNNGG 3 cut(s) 117, 147, 375
BssMI GATC 3 cut(s) 100, 156, 282
BssNI GRCGYC 1 cut(s) 114
BssT1I CCWWGG 2 cut(s) 147, 375
Bst2UI CCWGG 1 cut(s) 364
Bst4CI ACNGT 1 cut(s) 319
BstACI GRCGYC 1 cut(s) 114
BstAFI CTTAAG 1 cut(s) 244
BstDEI CTNAG 1 cut(s) 265
BstDSI CCRYGG 1 cut(s) 117
BstKTI GATC 3 cut(s) 103, 159, 285
BstMBI GATC 3 cut(s) 100, 156, 282
BstNI CCWGG 1 cut(s) 364
BstPAI GACNNNNGTC 1 cut(s) 149
BstSCI CCNGG 2 cut(s) 67, 362
BstXI CCANNNNNNTGG 1 cut(s) 47
BtgI CCRYGG 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 151
CseI GACGC 1 cut(s) 122
Csp6I GTAC 3 cut(s) 137, 249, 315
CviAII CATG 2 cut(s) 10, 104
CviJI RGCY 4 cut(s) 170, 222, 367, 387
CviKI_1 RGCY 4 cut(s) 170, 222, 367, 387
CviQI GTAC 3 cut(s) 137, 249, 315
DdeI CTNAG 1 cut(s) 265
DpnI GATC 3 cut(s) 102, 158, 284
DpnII GATC 3 cut(s) 100, 156, 282
Eco130I CCWWGG 2 cut(s) 147, 375
Eco24I GRGCYC 1 cut(s) 389
Eco32I GATATC 1 cut(s) 164
Eco47I GGWCC 1 cut(s) 151
EcoRII CCWGG 1 cut(s) 362
EcoRV GATATC 1 cut(s) 164
EcoT14I CCWWGG 2 cut(s) 147, 375
EcoT38I GRGCYC 1 cut(s) 389
ErhI CCWWGG 2 cut(s) 147, 375
FaeI CATG 2 cut(s) 13, 107
FaiI YATR 6 cut(s) 11, 99, 105, 255, 275, 391
FatI CATG 2 cut(s) 9, 103
FbaI TGATCA 1 cut(s) 100
FriOI GRGCYC 1 cut(s) 389
FspBI CTAG 1 cut(s) 219
HapII CCGG 4 cut(s) 69, 134, 167, 333
HgaI GACGC 1 cut(s) 122
Hin1I GRCGYC 1 cut(s) 114
Hin1II CATG 2 cut(s) 13, 107
HinfI GANTC 1 cut(s) 6
HpaII CCGG 4 cut(s) 69, 134, 167, 333
HphI GGTGA 1 cut(s) 190
Hpy166II GTNNAC 2 cut(s) 109, 183
Hpy188I TCNGA 3 cut(s) 161, 268, 306
Hpy188III TCNNGA 5 cut(s) 40, 81, 110, 142, 154
Hpy8I GTNNAC 2 cut(s) 109, 183
Hpy99I CGWCG 1 cut(s) 116
HpyCH4III ACNGT 1 cut(s) 319
HpyCH4V TGCA 2 cut(s) 13, 348
HpyF3I CTNAG 1 cut(s) 265
Hsp92I GRCGYC 1 cut(s) 114
Hsp92II CATG 2 cut(s) 13, 107
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 3 cut(s) 100, 156, 282
MaeI CTAG 1 cut(s) 219
MalI GATC 3 cut(s) 102, 158, 284
MboI GATC 3 cut(s) 100, 156, 282
MhlI GDGCHC 1 cut(s) 389
MluCI AATT 1 cut(s) 60
MlyI GAGTC 1 cut(s) 15
MroXI GAANNNNTTC 1 cut(s) 76
MseI TTAA 3 cut(s) 24, 59, 245
MspCI CTTAAG 1 cut(s) 244
MspI CCGG 4 cut(s) 69, 134, 167, 333
MspR9I CCNGG 2 cut(s) 69, 364
MvaI CCWGG 1 cut(s) 364
NciI CCSGG 1 cut(s) 69
NdeII GATC 3 cut(s) 100, 156, 282
NlaIII CATG 2 cut(s) 13, 107
PdmI GAANNNNTTC 1 cut(s) 76
PleI GAGTC 1 cut(s) 14
PpsI GAGTC 1 cut(s) 14
PshAI GACNNNNGTC 1 cut(s) 149
PshBI ATTAAT 1 cut(s) 59
Psp6I CCWGG 1 cut(s) 362
PspGI CCWGG 1 cut(s) 362
PspPI GGNCC 1 cut(s) 151
RsaI GTAC 3 cut(s) 138, 250, 316
RsaNI GTAC 3 cut(s) 137, 249, 315
SaqAI TTAA 3 cut(s) 24, 59, 245
Sau3AI GATC 3 cut(s) 100, 156, 282
Sau96I GGNCC 1 cut(s) 151
ScaI AGTACT 2 cut(s) 250, 316
SchI GAGTC 1 cut(s) 15
ScrFI CCNGG 2 cut(s) 69, 364
SduI GDGCHC 1 cut(s) 389
SetI ASST 4 cut(s) 98, 149, 224, 260
SinI GGWCC 1 cut(s) 151
SmlI CTYRAG 1 cut(s) 244
SmoI CTYRAG 1 cut(s) 244
Sse9I AATT 1 cut(s) 60
SspMI CTAG 1 cut(s) 219
StyD4I CCNGG 2 cut(s) 67, 362
StyI CCWWGG 2 cut(s) 147, 375
TaaI ACNGT 1 cut(s) 319
TasI AATT 1 cut(s) 60
TatI WGTACW 2 cut(s) 248, 314
Tru1I TTAA 3 cut(s) 24, 59, 245
Tru9I TTAA 3 cut(s) 24, 59, 245
TspDTI ATGAA 1 cut(s) 115
Vha464I CTTAAG 1 cut(s) 244
VpaK11BI GGWCC 1 cut(s) 151
VspI ATTAAT 1 cut(s) 59
XmnI GAANNNNTTC 1 cut(s) 76
XspI CTAG 1 cut(s) 219
ZrmI AGTACT 2 cut(s) 250, 316
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.