RchiOBHm_Chr2g0089881

The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
3935590 .. 3937027
1438 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
ATGTGTTCAAATGACTTTGTATGCTTCTATGACTGGGCAGAATGCAGATTGTTTAGACGAATTGATGTGAATGTTAAGAATGTTTATTGGGCTGATAGCGGTGATTTGGTGGCAATTTCTATCTCTTCTTATTTGGACAGTGGAAGGGCAGTCGACGAACTAGGTGTTGAGGATGTTTTTGAGCTCCTCTTGGAGAGAAATGAGCGTGTCCAAACTGGATTATGGGTTGGCGACTGTTTTGTTTATATTAGGAACTGA

Protein Analysis

85

Amino Acids

9.88

Weight (kDa)

4.29

Isoelectric Point (pI)

29.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B-prop_COPA_B_2nd PF04053 2 - 83 2.1e-19 COPA/B second beta-propeller
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 153
AciI CCGC 1 cut(s) 99
AgsI TTSAA 1 cut(s) 9
AluBI AGCT 1 cut(s) 184
AluI AGCT 1 cut(s) 184
Alw21I GWGCWC 1 cut(s) 186
AsuHPI GGTGA 1 cut(s) 113
BanII GRGCYC 1 cut(s) 186
Bbv12I GWGCWC 1 cut(s) 186
BfaI CTAG 1 cut(s) 161
BmrI ACTGGG 1 cut(s) 43
BmuI ACTGGG 1 cut(s) 43
Bse1I ACTGG 2 cut(s) 38, 220
BseGI GGATG 1 cut(s) 178
BseNI ACTGG 2 cut(s) 38, 220
BseRI GAGGAG 1 cut(s) 176
BsiHKAI GWGCWC 1 cut(s) 186
BsmI GAATGC 1 cut(s) 47
Bsp1286I GDGCHC 1 cut(s) 186
BspACI CCGC 1 cut(s) 99
BsrI ACTGG 2 cut(s) 38, 220
Bst4CI ACNGT 2 cut(s) 140, 236
Bst6I CTCTTC 1 cut(s) 130
BstF5I GGATG 1 cut(s) 178
BtsCI GGATG 1 cut(s) 178
BtsIMutI CAGTG 1 cut(s) 145
CviJI RGCY 2 cut(s) 92, 184
CviKI_1 RGCY 2 cut(s) 92, 184
Eam1104I CTCTTC 1 cut(s) 130
EarI CTCTTC 1 cut(s) 130
Ecl136II GAGCTC 1 cut(s) 184
Eco24I GRGCYC 1 cut(s) 186
Eco53kI GAGCTC 1 cut(s) 184
EcoICRI GAGCTC 1 cut(s) 184
EcoT38I GRGCYC 1 cut(s) 186
FaiI YATR 4 cut(s) 22, 30, 223, 246
FblI GTMKAC 1 cut(s) 153
FokI GGATG 1 cut(s) 185
FriOI GRGCYC 1 cut(s) 186
FspBI CTAG 1 cut(s) 161
HincII GTYRAC 1 cut(s) 154
HindII GTYRAC 1 cut(s) 154
HphI GGTGA 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 154
Hpy8I GTNNAC 1 cut(s) 154
Hpy99I CGWCG 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 138
HpyCH4III ACNGT 2 cut(s) 140, 236
HpyCH4V TGCA 1 cut(s) 45
LmnI GCTCC 1 cut(s) 189
LpnPI CCDG 2 cut(s) 19, 201
MaeI CTAG 1 cut(s) 161
MboII GAAGA 1 cut(s) 117
MhlI GDGCHC 1 cut(s) 186
MluCI AATT 2 cut(s) 60, 114
MnlI CCTC 2 cut(s) 163, 197
MseI TTAA 1 cut(s) 75
Mva1269I GAATGC 1 cut(s) 47
PctI GAATGC 1 cut(s) 47
Psp124BI GAGCTC 1 cut(s) 186
SacI GAGCTC 1 cut(s) 186
SalI GTCGAC 1 cut(s) 152
SaqAI TTAA 1 cut(s) 75
SduI GDGCHC 1 cut(s) 186
SetI ASST 2 cut(s) 166, 186
SgeI CNNG 5 cut(s) 46, 173, 202, 218, 228
Sse9I AATT 2 cut(s) 60, 114
SsiI CCGC 1 cut(s) 99
SspMI CTAG 1 cut(s) 161
SstI GAGCTC 1 cut(s) 186
TaaI ACNGT 2 cut(s) 140, 236
TaqI TCGA 1 cut(s) 153
TasI AATT 2 cut(s) 60, 114
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 1 cut(s) 145
TspRI CASTG 1 cut(s) 145
XmiI GTMKAC 1 cut(s) 153
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.