Rmu_sc0001608.1_g000018

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001608.1
OG0000292
Physical Location & Seq
Reverse (-)
122781 .. 123883
1103 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001608.1_g000018.1.cds

Sequence Viewer

Length: 699 bp
atggattggccaacaaggcacaggatctgtgttggtatagcaaaaggtttggcttacctccatgaggaatcaaggttgaagatcgtccatagagactttaaagctactaatgtgctactcgataaaaatctttgtccaaagatagctgattttggattgaccaagcttgatgaagaggataatacccacataagcactcggattgctggaaatctaggatatatggcacctgaatatgcaatgtcaggttatctgactgataaagcagatgtttatagttacggaattggtgtgttggaagtagtcagtgggaggagcaacacaacttaccgctccgaagaagaattggatccaaggctaggctcagagtttaacaaagaacaagtgattgctacaatcaatgtggctctcctttgctctcatgattcttcagcagttaggccttccatgtcttcagtggtgaaaatgcttgaaggaagggcttccgttcaagaggtgatctccgatccaaatgcctcaaacaatgaaatcaatgcaatgaggaaacattttcaatccagttttgaagaaaacaatggtgaccttgagagtcagggacaaactatgtcaattgaaccattgtggactgcttcatctacatctgctcatgatcactatcttgtccatcctgattccagttattgggagaacagaaaatag

Protein Analysis

232

Amino Acids

25.96

Weight (kDa)

5.36

Isoelectric Point (pI)

46.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000292)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G53420 AT3G14840
fragaria_vesca FvH4_3g17840 FvH4_3g17840 FvH4_3g17840 FvH4_3g17840 FvH4_3g17840 FvH4_3g17840 FvH4_3g17841 FvH4_3g17841 FvH4_3g17841 FvH4_3g17841 FvH4_3g17841 FvH4_3g17841 FvH4_3g17850 FvH4_3g17850 FvH4_3g17850 FvH4_3g17850 FvH4_3g17851
malus_domestica MD03G1246600.v1.1 MD06G1045200.v1.1 MD06G1045400.v1.1 MD11G1267800.v1.1 MD11G1267900.v1.1 MD11G1268100.v1.1 MD11G1268300.v1.1 MD11G1268500.v1.1 MD11G1268600.v1.1
prunus_persica Prupe.4G157700_v2.0.a1 Prupe.4G157700_v2.0.a1 Prupe.4G157800_v2.0.a1 Prupe.4G157800_v2.0.a1 Prupe.4G157800_v2.0.a1 Prupe.4G157800_v2.0.a1 Prupe.4G157800_v2.0.a1 Prupe.4G157900_v2.0.a1 Prupe.4G157900_v2.0.a1 Prupe.4G157900_v2.0.a1
pyrus_communis pycom03g19540 pycom11g23600 pycom11g23630 pycom11g23690 pycom11g23720 pycom11g23730 pycom11g23740 pycom11g23750
rosa_chinensis RchiOBHm_Chr0c40g0503411 RchiOBHm_Chr0c40g0503421 RchiOBHm_Chr5g0029631 RchiOBHm_Chr5g0029661 RchiOBHm_Chr5g0029701 RchiOBHm_Chr5g0029741 RchiOBHm_Chr5g0029771 RchiOBHm_Chr5g0029781 RchiOBHm_Chr5g0029811 RchiOBHm_Chr5g0029851 RchiOBHm_Chr5g0029871 RchiOBHm_Chr5g0029891 RchiOBHm_Chr7g0222221
rosa_laevigata RLG00000017380 RLG00000032873 RLG00000033188 RLG00000033190 RLG00000033192 RLG00000033193 RLG00000033194 RLG00000033196 RLG00000033199 RLG00000033238
rosa_multiflora Rmu_co8359987.1_g000001 Rmu_co8444909.1_g000001 Rmu_sc0001608.1_g000007 Rmu_sc0001608.1_g000009 Rmu_sc0001608.1_g000013 Rmu_sc0001608.1_g000018 Rmu_sc0001608.1_g000023 Rmu_sc0001608.1_g000040 Rmu_sc0003238.1_g000016 Rmu_sc0003368.1_g000026 Rmu_sc0003368.1_g000034 Rmu_sc0003368.1_g000043 Rmu_sc0003368.1_g000047 Rmu_sc0003368.1_g000052 Rmu_sc0003368.1_g000054 Rmu_sc0004963.1_g000001
rosa_roxburghii Rroxscaffold_1G00050080 Rroxscaffold_1G00050090 Rroxscaffold_1G00050110 Rroxscaffold_1G00050120 Rroxscaffold_1G00050180 Rroxscaffold_1G00050190 Rroxscaffold_1G00050220 Rroxscaffold_1G00050270 Rroxscaffold_1G00050300
rosa_rugosa Rorug04G0065200 Rorug05G0114900 Rorug05G0115000 Rorug05G0115100 Rorug05G0120100 Rorug05G0238900
rosa_samantha Rh5AG207800 Rh5AG208000 Rh5AG208300 Rh5AG208400 Rh5AG208800 Rh5AG294900 Rh5AG295000 Rh5AG295400 Rh5CG230400 Rh7AG347800
rosa_wichuraiana Rw0G005370 Rw0G012460 Rw0G019060 Rw5G018910 Rw5G018920 Rw5G018930 Rw5G018940 Rw5G018960 Rw5G018970 Rw5G018980 Rw5G018990 Rw5G019000 Rw7G029840

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 226
AccB7I CCANNNNNTGG 1 cut(s) 681
AccBSI CCGCTC 1 cut(s) 333
AciI CCGC 1 cut(s) 331
AclWI GGATC 4 cut(s) 32, 344, 357, 500
AcoI YGGCCR 1 cut(s) 8
AcuI CTGAAG 2 cut(s) 414, 438
AfiI CCNNNNNNNGG 3 cut(s) 64, 359, 681
AgsI TTSAA 6 cut(s) 79, 473, 491, 554, 566, 614
AluBI AGCT 3 cut(s) 104, 146, 166
AluI AGCT 3 cut(s) 104, 146, 166
Alw26I GTCTC 1 cut(s) 87
AlwI GGATC 4 cut(s) 32, 344, 357, 500
AlwNI CAGNNNCTG 1 cut(s) 27
AoxI GGCC 2 cut(s) 8, 440
Asp700I GAANNNNTTC 1 cut(s) 481
AsuHPI GGTGA 3 cut(s) 472, 508, 590
BalI TGGCCA 1 cut(s) 10
BamHI GGATCC 1 cut(s) 349
BanI GGYRCC 1 cut(s) 226
BbsI GAAGAC 1 cut(s) 444
BccI CCATC 1 cut(s) 672
BcgI CGANNNNNNTGC 2 cut(s) 494, 528
BclI TGATCA 1 cut(s) 649
BcoDI GTCTC 1 cut(s) 87
BfaI CTAG 2 cut(s) 215, 359
BglI GCCNNNNNGGC 1 cut(s) 16
BmiI GGNNCC 2 cut(s) 228, 351
BpiI GAAGAC 1 cut(s) 444
BplI GAGNNNNNCTC 2 cut(s) 485, 517
BpuEI CTTGAG 1 cut(s) 605
BsaBI GATNNNNATC 2 cut(s) 126, 654
BsaJI CCNNGG 1 cut(s) 353
Bsc4I CCNNNNNNNGG 3 cut(s) 64, 359, 681
Bse1I ACTGG 2 cut(s) 558, 675
Bse3DI GCAATG 2 cut(s) 246, 543
Bse8I GATNNNNATC 2 cut(s) 126, 654
BseDI CCNNGG 1 cut(s) 353
BseGI GGATG 1 cut(s) 664
BseJI GATNNNNATC 2 cut(s) 126, 654
BseLI CCNNNNNNNGG 3 cut(s) 64, 359, 681
BseMI GCAATG 2 cut(s) 246, 543
BseMII CTCAG 1 cut(s) 378
BseNI ACTGG 2 cut(s) 558, 675
BseRI GAGGAG 1 cut(s) 328
BshFI GGCC 2 cut(s) 10, 442
BshNI GGYRCC 1 cut(s) 226
BslFI GGGAC 1 cut(s) 609
BslI CCNNNNNNNGG 3 cut(s) 64, 359, 681
BsmAI GTCTC 1 cut(s) 87
BsmFI GGGAC 1 cut(s) 609
BsnI GGCC 2 cut(s) 10, 442
Bsp143I GATC 6 cut(s) 24, 81, 349, 498, 505, 649
BspACI CCGC 1 cut(s) 331
BspANI GGCC 2 cut(s) 10, 442
BspCNI CTCAG 1 cut(s) 377
BspHI TCATGA 2 cut(s) 421, 646
BspLI GGNNCC 2 cut(s) 228, 351
BspPI GGATC 4 cut(s) 32, 344, 357, 500
BspT107I GGYRCC 1 cut(s) 226
BsrBI CCGCTC 1 cut(s) 333
BsrDI GCAATG 2 cut(s) 246, 543
BsrI ACTGG 2 cut(s) 558, 675
BssECI CCNNGG 1 cut(s) 353
BssMI GATC 6 cut(s) 24, 81, 349, 498, 505, 649
BssT1I CCWWGG 1 cut(s) 353
Bst6I CTCTTC 1 cut(s) 168
BstDEI CTNAG 1 cut(s) 364
BstEII GGTNACC 1 cut(s) 578
BstENI CCTNNNNNAGG 1 cut(s) 62
BstF5I GGATG 1 cut(s) 664
BstKTI GATC 6 cut(s) 27, 84, 352, 501, 508, 652
BstMAI GTCTC 1 cut(s) 87
BstMBI GATC 6 cut(s) 24, 81, 349, 498, 505, 649
BstMWI GCNNNNNNNGC 1 cut(s) 16
BstPI GGTNACC 1 cut(s) 578
BstV2I GAAGAC 1 cut(s) 444
BstX2I RGATCY 2 cut(s) 24, 349
BstYI RGATCY 2 cut(s) 24, 349
BsuRI GGCC 2 cut(s) 10, 442
BtsCI GGATG 1 cut(s) 664
BtsIMutI CAGTG 2 cut(s) 313, 462
CaiI CAGNNNCTG 1 cut(s) 27
CciI TCATGA 2 cut(s) 421, 646
CspCI CAANNNNNGTGG 2 cut(s) 384, 419
CviAII CATG 4 cut(s) 62, 422, 448, 647
DdeI CTNAG 1 cut(s) 364
DpnI GATC 6 cut(s) 26, 83, 351, 500, 507, 651
DpnII GATC 6 cut(s) 24, 81, 349, 498, 505, 649
DraI TTTAAA 1 cut(s) 100
EaeI YGGCCR 1 cut(s) 8
Eam1104I CTCTTC 1 cut(s) 168
EarI CTCTTC 1 cut(s) 168
Eco130I CCWWGG 1 cut(s) 353
Eco147I AGGCCT 1 cut(s) 442
Eco57I CTGAAG 2 cut(s) 414, 438
Eco91I GGTNACC 1 cut(s) 578
EcoNI CCTNNNNNAGG 1 cut(s) 62
EcoO65I GGTNACC 1 cut(s) 578
EcoT14I CCWWGG 1 cut(s) 353
ErhI CCWWGG 1 cut(s) 353
FaeI CATG 4 cut(s) 65, 425, 451, 650
FaqI GGGAC 1 cut(s) 609
FatI CATG 4 cut(s) 61, 421, 447, 646
FbaI TGATCA 1 cut(s) 649
FokI GGATG 1 cut(s) 651
FspBI CTAG 2 cut(s) 215, 359
HaeIII GGCC 2 cut(s) 10, 442
Hin1II CATG 4 cut(s) 65, 425, 451, 650
HindIII AAGCTT 1 cut(s) 164
HinfI GANTC 4 cut(s) 68, 425, 589, 671
HphI GGTGA 3 cut(s) 472, 508, 590
Hpy166II GTNNAC 1 cut(s) 624
Hpy188I TCNGA 5 cut(s) 201, 255, 337, 367, 505
Hpy188III TCNNGA 4 cut(s) 422, 491, 647, 668
Hpy8I GTNNAC 1 cut(s) 624
HpyAV CCTTC 3 cut(s) 453, 467, 471
HpyCH4V TGCA 2 cut(s) 239, 536
HpyF10VI GCNNNNNNNGC 1 cut(s) 16
HpyF3I CTNAG 1 cut(s) 364
Hsp92II CATG 4 cut(s) 65, 425, 451, 650
Ksp22I TGATCA 1 cut(s) 649
Kzo9I GATC 6 cut(s) 24, 81, 349, 498, 505, 649
LmnI GCTCC 2 cut(s) 315, 338
LpnPI CCDG 8 cut(s) 7, 192, 231, 243, 571, 578, 681, 688
MaeI CTAG 2 cut(s) 215, 359
MaeIII GTNAC 2 cut(s) 278, 578
MalI GATC 6 cut(s) 26, 83, 351, 500, 507, 651
MbiI CCGCTC 1 cut(s) 333
MboI GATC 6 cut(s) 24, 81, 349, 498, 505, 649
MboII GAAGA 7 cut(s) 91, 185, 350, 353, 420, 444, 578
MfeI CAATTG 1 cut(s) 609
MflI RGATCY 2 cut(s) 24, 349
MlsI TGGCCA 1 cut(s) 10
MluCI AATT 3 cut(s) 285, 344, 609
MluNI TGGCCA 1 cut(s) 10
MlyI GAGTC 1 cut(s) 598
MmeI TCCRAC 1 cut(s) 276
MnlI CCTC 7 cut(s) 58, 68, 169, 306, 487, 526, 534
Mox20I TGGCCA 1 cut(s) 10
MroXI GAANNNNTTC 1 cut(s) 481
MscI TGGCCA 1 cut(s) 10
MseI TTAA 2 cut(s) 99, 372
Msp20I TGGCCA 1 cut(s) 10
MunI CAATTG 1 cut(s) 609
MwoI GCNNNNNNNGC 1 cut(s) 16
NdeII GATC 6 cut(s) 24, 81, 349, 498, 505, 649
NlaIII CATG 4 cut(s) 65, 425, 451, 650
NlaIV GGNNCC 2 cut(s) 228, 351
NmuCI GTSAC 1 cut(s) 578
PagI TCATGA 2 cut(s) 421, 646
PceI AGGCCT 1 cut(s) 442
PdmI GAANNNNTTC 1 cut(s) 481
PfeI GAWTC 3 cut(s) 68, 425, 671
PflMI CCANNNNNTGG 1 cut(s) 681
PleI GAGTC 1 cut(s) 597
PpsI GAGTC 1 cut(s) 597
PspEI GGTNACC 1 cut(s) 578
PspN4I GGNNCC 2 cut(s) 228, 351
PstNI CAGNNNCTG 1 cut(s) 27
PsuI RGATCY 2 cut(s) 24, 349
SaqAI TTAA 2 cut(s) 99, 372
Sau3AI GATC 6 cut(s) 24, 81, 349, 498, 505, 649
SchI GAGTC 1 cut(s) 598
SmlI CTYRAG 1 cut(s) 584
SmoI CTYRAG 1 cut(s) 584
Sse9I AATT 3 cut(s) 285, 344, 609
SseBI AGGCCT 1 cut(s) 442
SsiI CCGC 1 cut(s) 331
SspMI CTAG 2 cut(s) 215, 359
StuI AGGCCT 1 cut(s) 442
StyI CCWWGG 1 cut(s) 353
TaqI TCGA 1 cut(s) 120
TasI AATT 3 cut(s) 285, 344, 609
TfiI GAWTC 3 cut(s) 68, 425, 671
Tru1I TTAA 2 cut(s) 99, 372
Tru9I TTAA 2 cut(s) 99, 372
TscAI CASTG 2 cut(s) 313, 462
TseFI GTSAC 1 cut(s) 578
Tsp45I GTSAC 1 cut(s) 578
TspDTI ATGAA 3 cut(s) 186, 540, 621
TspGWI ACGGA 2 cut(s) 297, 475
TspRI CASTG 2 cut(s) 313, 462
Van91I CCANNNNNTGG 1 cut(s) 681
XagI CCTNNNNNAGG 1 cut(s) 62
XcmI CCANNNNNNNNNTGG 1 cut(s) 454
XmnI GAANNNNTTC 1 cut(s) 481
XspI CTAG 2 cut(s) 215, 359
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.