Rmu_sc0004963.1_g000001

leucine-rich repeat receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004963.1
Physical Location & Seq
Forward (+)
262 .. 3636
3375 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004963.1_g000001.1.cds

Sequence Viewer

Length: 1356 bp
atgctagtattgaaagattttaacattatgaaggaagcaggtggggccggtaaggtagtagtaaagaaatttaacgcctctgtgaccagtaggacattagagatccgtttggcttgggctgggaaagggaccactggaatccctttcggaggagtctatggtcctttgatatctgccatttctgtagaatatgacttcgtatacttgcacaaagacagaccaagaggtggaatctctgtaggtgtagtagttgggatggtggttggattcgtgttagttgtctcactggtttgtggtatcctttggtggagaggtctcctaagtctaagacgtgaaaaggctcttgaacaagattttaagggtgttgacctgcaaacaagaaaattcacctggaagcaaatcagagatgccaccaacaactttgacatagccaacaaaattggtgaaggtggttttggtgctgtttacaaggatattgatcatgtttctactattcagggccttctatcaaatggcacctcagttgctgttaagcagctttctacccagtcgaagcaagggaatcgggagtttctcaacgaaataggcataatttctgctctgcgacaccctaatcttgttgagctttttggctgctgtgttgagggcgatcaattgatgctagtgtatgagtacatggaaaagaatagtcttgcacgtgctttgtttgcgagaggtttggcgtacctccatgaggaatcaaggatgaagataatccacagagatatcaaggctacaaacgtgcttcttggtgaagacttccttcccaaaatatcagattttgggttggcaaagcttgatgaaggagataagactcacatgtctacagagaccagtggaacttatgggtatatggccccagaatatgcattgcatggccatctctctgacaaagctgatgtttatagtttcgggattgttgtgctcgaaattgtcagtggacggagcaggaacagcaacccgacaaatgaagaaggtgtttatctcgttgattgggcacatggtcttcgggaagagcagaaattgttggaagtagtggatgcgagattggggggagaatttgatagtgttgagatgatcaccacgatcaaagtggctctcgtttgctcgcacgagattgcagccaacaggcctagcatgtctttagtagtgaacatgcttgtgggcgacgcactagttcctgaattcgtttccactacatcaaataatgaggacaacccttggtttgagagaagtttccaggcccttgttccaggagacgtggacagctccatatcgaaacacagtaatgagatcactatagaagatgatttgtga

Protein Analysis

451

Amino Acids

49.69

Weight (kDa)

5.48

Isoelectric Point (pI)

27.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000292)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G53420 AT3G14840
fragaria_vesca FvH4_3g17840 FvH4_3g17840 FvH4_3g17840 FvH4_3g17840 FvH4_3g17840 FvH4_3g17840 FvH4_3g17841 FvH4_3g17841 FvH4_3g17841 FvH4_3g17841 FvH4_3g17841 FvH4_3g17841 FvH4_3g17850 FvH4_3g17850 FvH4_3g17850 FvH4_3g17850 FvH4_3g17851
malus_domestica MD03G1246600.v1.1 MD06G1045200.v1.1 MD06G1045400.v1.1 MD11G1267800.v1.1 MD11G1267900.v1.1 MD11G1268100.v1.1 MD11G1268300.v1.1 MD11G1268500.v1.1 MD11G1268600.v1.1
prunus_persica Prupe.4G157700_v2.0.a1 Prupe.4G157700_v2.0.a1 Prupe.4G157800_v2.0.a1 Prupe.4G157800_v2.0.a1 Prupe.4G157800_v2.0.a1 Prupe.4G157800_v2.0.a1 Prupe.4G157800_v2.0.a1 Prupe.4G157900_v2.0.a1 Prupe.4G157900_v2.0.a1 Prupe.4G157900_v2.0.a1
pyrus_communis pycom03g19540 pycom11g23600 pycom11g23630 pycom11g23690 pycom11g23720 pycom11g23730 pycom11g23740 pycom11g23750
rosa_chinensis RchiOBHm_Chr0c40g0503411 RchiOBHm_Chr0c40g0503421 RchiOBHm_Chr5g0029631 RchiOBHm_Chr5g0029661 RchiOBHm_Chr5g0029701 RchiOBHm_Chr5g0029741 RchiOBHm_Chr5g0029771 RchiOBHm_Chr5g0029781 RchiOBHm_Chr5g0029811 RchiOBHm_Chr5g0029851 RchiOBHm_Chr5g0029871 RchiOBHm_Chr5g0029891 RchiOBHm_Chr7g0222221
rosa_laevigata RLG00000017380 RLG00000032873 RLG00000033188 RLG00000033190 RLG00000033192 RLG00000033193 RLG00000033194 RLG00000033196 RLG00000033199 RLG00000033238
rosa_multiflora Rmu_co8359987.1_g000001 Rmu_co8444909.1_g000001 Rmu_sc0001608.1_g000007 Rmu_sc0001608.1_g000009 Rmu_sc0001608.1_g000013 Rmu_sc0001608.1_g000018 Rmu_sc0001608.1_g000023 Rmu_sc0001608.1_g000040 Rmu_sc0003238.1_g000016 Rmu_sc0003368.1_g000026 Rmu_sc0003368.1_g000034 Rmu_sc0003368.1_g000043 Rmu_sc0003368.1_g000047 Rmu_sc0003368.1_g000052 Rmu_sc0003368.1_g000054 Rmu_sc0004963.1_g000001
rosa_roxburghii Rroxscaffold_1G00050080 Rroxscaffold_1G00050090 Rroxscaffold_1G00050110 Rroxscaffold_1G00050120 Rroxscaffold_1G00050180 Rroxscaffold_1G00050190 Rroxscaffold_1G00050220 Rroxscaffold_1G00050270 Rroxscaffold_1G00050300
rosa_rugosa Rorug04G0065200 Rorug05G0114900 Rorug05G0115000 Rorug05G0115100 Rorug05G0120100 Rorug05G0238900
rosa_samantha Rh5AG207800 Rh5AG208000 Rh5AG208300 Rh5AG208400 Rh5AG208800 Rh5AG294900 Rh5AG295000 Rh5AG295400 Rh5CG230400 Rh7AG347800
rosa_wichuraiana Rw0G005370 Rw0G012460 Rw0G019060 Rw5G018910 Rw5G018920 Rw5G018930 Rw5G018940 Rw5G018960 Rw5G018970 Rw5G018980 Rw5G018990 Rw5G019000 Rw7G029840

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 29
AasI GACNNNNNNGTC 1 cut(s) 859
Acc36I ACCTGC 2 cut(s) 29, 378
AccB1I GGYRCC 1 cut(s) 515
AccB7I CCANNNNNTGG 1 cut(s) 227
AccI GTMKAC 2 cut(s) 201, 863
AclWI GGATC 1 cut(s) 97
AcoI YGGCCR 1 cut(s) 916
AcsI RAATTY 4 cut(s) 68, 383, 1097, 1223
AcvI CACGTG 1 cut(s) 698
AfaI GTAC 2 cut(s) 674, 725
AfiI CCNNNNNNNGG 3 cut(s) 149, 227, 733
AflIII ACRYGT 1 cut(s) 858
AgsI TTSAA 2 cut(s) 13, 347
AhlI ACTAGT 1 cut(s) 1213
AjiI CACGTC 2 cut(s) 332, 1300
AjnI CCWGG 3 cut(s) 389, 1278, 1291
AjuI GAANNNNNNNTTGG 2 cut(s) 438, 470
AluBI AGCT 5 cut(s) 538, 625, 835, 935, 1308
AluI AGCT 5 cut(s) 538, 625, 835, 935, 1308
Alw21I GWGCWC 1 cut(s) 966
Alw26I GTCTC 4 cut(s) 286, 320, 863, 1290
AlwI GGATC 1 cut(s) 97
AlwNI CAGNNNCTG 1 cut(s) 527
AoxI GGCC 6 cut(s) 45, 499, 894, 916, 1169, 1281
ApeKI GCWGC 3 cut(s) 535, 633, 1160
ApoI RAATTY 4 cut(s) 68, 383, 1097, 1223
AspS9I GGNCC 6 cut(s) 45, 129, 161, 499, 895, 1282
AsuHPI GGTGA 4 cut(s) 379, 455, 803, 1111
AvaII GGWCC 2 cut(s) 129, 161
BaeGI GKGCMC 1 cut(s) 1039
BalI TGGCCA 1 cut(s) 918
BanI GGYRCC 1 cut(s) 515
BauI CACGAG 1 cut(s) 1151
BbrPI CACGTG 1 cut(s) 698
BbsI GAAGAC 2 cut(s) 801, 1037
Bbv12I GWGCWC 1 cut(s) 966
BbvI GCAGC 3 cut(s) 547, 620, 1172
BccI CCATC 2 cut(s) 250, 927
BcgI CGANNNNNNTGC 2 cut(s) 545, 579
BciT130I CCWGG 3 cut(s) 391, 1280, 1293
BciVI GTATCC 1 cut(s) 308
BclI TGATCA 2 cut(s) 478, 1116
BcoDI GTCTC 4 cut(s) 286, 320, 863, 1290
BcuI ACTAGT 1 cut(s) 1213
BfaI CTAG 4 cut(s) 5, 662, 1173, 1214
BfmI CTRYAG 4 cut(s) 183, 237, 864, 1338
BfuAI ACCTGC 2 cut(s) 29, 378
BfuI GTATCC 1 cut(s) 308
BisI GCNGC 3 cut(s) 536, 634, 1161
BlsI GCNGC 3 cut(s) 537, 635, 1162
Bme1390I CCNGG 3 cut(s) 391, 1280, 1293
Bme18I GGWCC 2 cut(s) 129, 161
BmgBI CACGTC 2 cut(s) 332, 1300
BmgT120I GGNCC 6 cut(s) 45, 129, 161, 499, 895, 1282
BmiI GGNNCC 4 cut(s) 46, 130, 517, 897
BmrFI CCNGG 3 cut(s) 391, 1280, 1293
BmrI ACTGGG 1 cut(s) 541
BmsI GCATC 3 cut(s) 397, 648, 1069
BmuI ACTGGG 1 cut(s) 541
BpiI GAAGAC 2 cut(s) 801, 1037
BsaAI YACGTR 1 cut(s) 698
BsaBI GATNNNNATC 1 cut(s) 477
BsaI GGTCTC 2 cut(s) 320, 863
BsaJI CCNNGG 1 cut(s) 1259
Bsc4I CCNNNNNNNGG 3 cut(s) 149, 227, 733
Bse118I RCCGGY 1 cut(s) 47
Bse1I ACTGG 5 cut(s) 87, 139, 291, 547, 873
Bse3DI GCAATG 1 cut(s) 908
Bse8I GATNNNNATC 1 cut(s) 477
BseBI CCWGG 3 cut(s) 391, 1280, 1293
BseDI CCNNGG 1 cut(s) 1259
BseGI GGATG 3 cut(s) 261, 750, 1084
BseJI GATNNNNATC 1 cut(s) 477
BseLI CCNNNNNNNGG 3 cut(s) 149, 227, 733
BseMI GCAATG 1 cut(s) 908
BseMII CTCAG 1 cut(s) 534
BseNI ACTGG 5 cut(s) 87, 139, 291, 547, 873
BseRI GAGGAG 1 cut(s) 165
BseSI GKGCMC 1 cut(s) 1039
BseXI GCAGC 3 cut(s) 547, 620, 1172
BseYI CCCAGC 1 cut(s) 119
BshFI GGCC 6 cut(s) 47, 501, 896, 918, 1171, 1283
BshNI GGYRCC 1 cut(s) 515
BsiHKAI GWGCWC 1 cut(s) 966
BsiSI CCGG 1 cut(s) 48
BslFI GGGAC 1 cut(s) 142
BslI CCNNNNNNNGG 3 cut(s) 149, 227, 733
BsmAI GTCTC 4 cut(s) 286, 320, 863, 1290
BsmBI CGTCTC 1 cut(s) 1290
BsmFI GGGAC 1 cut(s) 142
BsnI GGCC 6 cut(s) 47, 501, 896, 918, 1171, 1283
Bso31I GGTCTC 2 cut(s) 320, 863
Bsp1286I GDGCHC 2 cut(s) 966, 1039
Bsp143I GATC 6 cut(s) 102, 478, 649, 1116, 1125, 1332
BspANI GGCC 6 cut(s) 47, 501, 896, 918, 1171, 1283
BspCNI CTCAG 1 cut(s) 533
BspLI GGNNCC 4 cut(s) 46, 130, 517, 897
BspMI ACCTGC 2 cut(s) 29, 378
BspPI GGATC 1 cut(s) 97
BspQI GCTCTTC 1 cut(s) 1047
BspT107I GGYRCC 1 cut(s) 515
BspTNI GGTCTC 2 cut(s) 320, 863
BsrDI GCAATG 1 cut(s) 908
BsrFI RCCGGY 1 cut(s) 47
BsrI ACTGG 5 cut(s) 87, 139, 291, 547, 873
BssAI RCCGGY 1 cut(s) 47
BssECI CCNNGG 1 cut(s) 1259
BssMI GATC 6 cut(s) 102, 478, 649, 1116, 1125, 1332
BssNAI GTATAC 1 cut(s) 202
BssSI CACGAG 1 cut(s) 1151
BssT1I CCWWGG 1 cut(s) 1259
Bst1107I GTATAC 1 cut(s) 202
Bst2BI CACGAG 1 cut(s) 1151
Bst2UI CCWGG 3 cut(s) 391, 1280, 1293
Bst4CI ACNGT 1 cut(s) 1325
Bst6I CTCTTC 1 cut(s) 1047
BstBAI YACGTR 1 cut(s) 698
BstC8I GCNNGC 1 cut(s) 1148
BstDEI CTNAG 3 cut(s) 320, 326, 520
BstENI CCTNNNNNAGG 2 cut(s) 147, 731
BstF5I GGATG 3 cut(s) 261, 750, 1084
BstKTI GATC 6 cut(s) 105, 481, 652, 1119, 1128, 1335
BstMAI GTCTC 4 cut(s) 286, 320, 863, 1290
BstMBI GATC 6 cut(s) 102, 478, 649, 1116, 1125, 1332
BstMWI GCNNNNNNNGC 3 cut(s) 44, 707, 993
BstNI CCWGG 3 cut(s) 391, 1280, 1293
BstNSI RCATGY 3 cut(s) 862, 1180, 1198
BstSCI CCNGG 3 cut(s) 389, 1278, 1291
BstSFI CTRYAG 4 cut(s) 183, 237, 864, 1338
BstSLI GKGCMC 1 cut(s) 1039
BstV1I GCAGC 3 cut(s) 547, 620, 1172
BstV2I GAAGAC 2 cut(s) 801, 1037
BstX2I RGATCY 1 cut(s) 102
BstYI RGATCY 1 cut(s) 102
BstZ17I GTATAC 1 cut(s) 202
BsuI GTATCC 1 cut(s) 308
BsuRI GGCC 6 cut(s) 47, 501, 896, 918, 1171, 1283
BtrI CACGTC 2 cut(s) 332, 1300
BtsCI GGATG 3 cut(s) 261, 750, 1084
BtsIMutI CAGTG 4 cut(s) 132, 284, 880, 982
BveI ACCTGC 2 cut(s) 29, 378
Cac8I GCNNGC 1 cut(s) 1148
CaiI CAGNNNCTG 1 cut(s) 527
Cfr10I RCCGGY 1 cut(s) 47
Cfr13I GGNCC 6 cut(s) 45, 129, 161, 499, 895, 1282
CseI GACGC 1 cut(s) 1217
Csp6I GTAC 2 cut(s) 673, 724
CviAII CATG 8 cut(s) 482, 676, 731, 859, 914, 1040, 1177, 1195
CviQI GTAC 2 cut(s) 673, 724
DdeI CTNAG 3 cut(s) 320, 326, 520
DpnI GATC 6 cut(s) 104, 480, 651, 1118, 1127, 1334
DpnII GATC 6 cut(s) 102, 478, 649, 1116, 1125, 1332
DrdI GACNNNNNNGTC 1 cut(s) 859
DseDI GACNNNNNNGTC 1 cut(s) 859
EaeI YGGCCR 1 cut(s) 916
Eam1104I CTCTTC 1 cut(s) 1047
EarI CTCTTC 1 cut(s) 1047
Eco130I CCWWGG 1 cut(s) 1259
Eco147I AGGCCT 1 cut(s) 1171
Eco31I GGTCTC 2 cut(s) 320, 863
Eco32I GATATC 2 cut(s) 171, 766
Eco47I GGWCC 2 cut(s) 129, 161
Eco72I CACGTG 1 cut(s) 698
EcoNI CCTNNNNNAGG 2 cut(s) 147, 731
EcoO109I RGGNCCY 2 cut(s) 499, 1282
EcoRI GAATTC 1 cut(s) 1223
EcoRII CCWGG 3 cut(s) 389, 1278, 1291
EcoRV GATATC 2 cut(s) 171, 766
EcoT14I CCWWGG 1 cut(s) 1259
EcoT22I ATGCAT 1 cut(s) 910
ErhI CCWWGG 1 cut(s) 1259
Esp3I CGTCTC 1 cut(s) 1290
FaeI CATG 8 cut(s) 485, 679, 734, 862, 917, 1043, 1180, 1198
FalI AAGNNNNNCTT 2 cut(s) 786, 818
FaqI GGGAC 1 cut(s) 142
FatI CATG 8 cut(s) 481, 675, 730, 858, 913, 1039, 1176, 1194
FbaI TGATCA 2 cut(s) 478, 1116
FblI GTMKAC 2 cut(s) 201, 863
Fnu4HI GCNGC 3 cut(s) 536, 634, 1161
FokI GGATG 3 cut(s) 268, 757, 1091
Fsp4HI GCNGC 3 cut(s) 536, 634, 1161
FspBI CTAG 4 cut(s) 5, 662, 1173, 1214
GluI GCNGC 3 cut(s) 536, 634, 1161
GsaI CCCAGC 1 cut(s) 123
HaeIII GGCC 6 cut(s) 47, 501, 896, 918, 1171, 1283
HapII CCGG 1 cut(s) 48
HgaI GACGC 1 cut(s) 1217
Hin1II CATG 8 cut(s) 485, 679, 734, 862, 917, 1043, 1180, 1198
HincII GTYRAC 1 cut(s) 367
HindII GTYRAC 1 cut(s) 367
HindIII AAGCTT 1 cut(s) 833
HinfI GANTC 7 cut(s) 138, 153, 231, 267, 562, 737, 853
HpaII CCGG 1 cut(s) 48
HphI GGTGA 4 cut(s) 379, 455, 803, 1111
Hpy166II GTNNAC 7 cut(s) 202, 367, 466, 864, 980, 1192, 1303
Hpy188I TCNGA 4 cut(s) 149, 404, 817, 928
Hpy188III TCNNGA 5 cut(s) 344, 566, 952, 1049, 1220
Hpy8I GTNNAC 7 cut(s) 202, 367, 466, 864, 980, 1192, 1303
Hpy99I CGWCG 1 cut(s) 1211
HpyAV CCTTC 6 cut(s) 25, 440, 512, 812, 836, 1007
HpyCH4III ACNGT 1 cut(s) 1325
HpyCH4IV ACGT 4 cut(s) 331, 697, 780, 1299
HpyCH4V TGCA 6 cut(s) 208, 373, 695, 908, 913, 1160
HpyF10VI GCNNNNNNNGC 3 cut(s) 44, 707, 993
HpyF3I CTNAG 3 cut(s) 320, 326, 520
HpySE526I ACGT 4 cut(s) 331, 697, 780, 1299
Hsp92II CATG 8 cut(s) 485, 679, 734, 862, 917, 1043, 1180, 1198
Ksp22I TGATCA 2 cut(s) 478, 1116
Kzo9I GATC 6 cut(s) 102, 478, 649, 1116, 1125, 1332
LguI GCTCTTC 1 cut(s) 1047
LmnI GCTCC 2 cut(s) 984, 1313
Lsp1109I GCAGC 3 cut(s) 547, 620, 1172
LweI GCATC 3 cut(s) 397, 648, 1069
MaeI CTAG 4 cut(s) 5, 662, 1173, 1214
MaeII ACGT 4 cut(s) 331, 697, 780, 1299
MaeIII GTNAC 1 cut(s) 82
MalI GATC 6 cut(s) 104, 480, 651, 1118, 1127, 1334
MboI GATC 6 cut(s) 102, 478, 649, 1116, 1125, 1332
MboII GAAGA 6 cut(s) 760, 806, 1022, 1037, 1064, 1355
MfeI CAATTG 1 cut(s) 653
MflI RGATCY 1 cut(s) 102
MhlI GDGCHC 2 cut(s) 966, 1039
MlsI TGGCCA 1 cut(s) 918
MluCI AATT 9 cut(s) 68, 383, 438, 591, 653, 969, 1061, 1097, 1223
MluNI TGGCCA 1 cut(s) 918
MlyI GAGTC 2 cut(s) 162, 847
MmeI TCCRAC 2 cut(s) 244, 1047
Mox20I TGGCCA 1 cut(s) 918
Mph1103I ATGCAT 1 cut(s) 910
MscI TGGCCA 1 cut(s) 918
MseI TTAA 4 cut(s) 21, 72, 357, 531
MslI CAYNNNNRTG 2 cut(s) 1199, 1326
Msp20I TGGCCA 1 cut(s) 918
MspI CCGG 1 cut(s) 48
MspR9I CCNGG 3 cut(s) 391, 1280, 1293
MunI CAATTG 1 cut(s) 653
MvaI CCWGG 3 cut(s) 391, 1280, 1293
MwoI GCNNNNNNNGC 3 cut(s) 44, 707, 993
NdeII GATC 6 cut(s) 102, 478, 649, 1116, 1125, 1332
NlaIII CATG 8 cut(s) 485, 679, 734, 862, 917, 1043, 1180, 1198
NlaIV GGNNCC 4 cut(s) 46, 130, 517, 897
NmuCI GTSAC 1 cut(s) 82
NsiI ATGCAT 1 cut(s) 910
NspI RCATGY 3 cut(s) 862, 1180, 1198
PaqCI CACCTGC 1 cut(s) 29
PceI AGGCCT 1 cut(s) 1171
PciI ACATGT 1 cut(s) 858
PciSI GCTCTTC 1 cut(s) 1047
PfeI GAWTC 5 cut(s) 138, 231, 267, 562, 737
PflMI CCANNNNNTGG 1 cut(s) 227
PfoI TCCNGGA 1 cut(s) 1291
PkrI GCNGC 3 cut(s) 537, 635, 1162
PleI GAGTC 2 cut(s) 161, 847
PmaCI CACGTG 1 cut(s) 698
PmlI CACGTG 1 cut(s) 698
PpsI GAGTC 2 cut(s) 161, 847
Ppu21I YACGTR 1 cut(s) 698
PscI ACATGT 1 cut(s) 858
Psp6I CCWGG 3 cut(s) 389, 1278, 1291
PspCI CACGTG 1 cut(s) 698
PspFI CCCAGC 1 cut(s) 119
PspGI CCWGG 3 cut(s) 389, 1278, 1291
PspN4I GGNNCC 4 cut(s) 46, 130, 517, 897
PspPI GGNCC 6 cut(s) 45, 129, 161, 499, 895, 1282
PstNI CAGNNNCTG 1 cut(s) 527
PsuI RGATCY 1 cut(s) 102
RsaI GTAC 2 cut(s) 674, 725
RsaNI GTAC 2 cut(s) 673, 724
RseI CAYNNNNRTG 2 cut(s) 1199, 1326
SapI GCTCTTC 1 cut(s) 1047
SaqAI TTAA 4 cut(s) 21, 72, 357, 531
SatI GCNGC 3 cut(s) 536, 634, 1161
Sau3AI GATC 6 cut(s) 102, 478, 649, 1116, 1125, 1332
Sau96I GGNCC 6 cut(s) 45, 129, 161, 499, 895, 1282
SchI GAGTC 2 cut(s) 162, 847
ScrFI CCNGG 3 cut(s) 391, 1280, 1293
SduI GDGCHC 2 cut(s) 966, 1039
SfaNI GCATC 3 cut(s) 397, 648, 1069
SfcI CTRYAG 4 cut(s) 183, 237, 864, 1338
SinI GGWCC 2 cut(s) 129, 161
SmiMI CAYNNNNRTG 2 cut(s) 1199, 1326
SpeI ACTAGT 1 cut(s) 1213
Sse9I AATT 9 cut(s) 68, 383, 438, 591, 653, 969, 1061, 1097, 1223
SseBI AGGCCT 1 cut(s) 1171
SspMI CTAG 4 cut(s) 5, 662, 1173, 1214
StuI AGGCCT 1 cut(s) 1171
StyD4I CCNGG 3 cut(s) 389, 1278, 1291
StyI CCWWGG 1 cut(s) 1259
TaaI ACNGT 1 cut(s) 1325
TaiI ACGT 4 cut(s) 334, 700, 783, 1302
TaqI TCGA 3 cut(s) 551, 966, 1316
TasI AATT 9 cut(s) 68, 383, 438, 591, 653, 969, 1061, 1097, 1223
TatI WGTACW 1 cut(s) 672
TfiI GAWTC 5 cut(s) 138, 231, 267, 562, 737
Tru1I TTAA 4 cut(s) 21, 72, 357, 531
Tru9I TTAA 4 cut(s) 21, 72, 357, 531
TscAI CASTG 4 cut(s) 139, 291, 880, 982
TseFI GTSAC 1 cut(s) 82
TseI GCWGC 3 cut(s) 535, 633, 1160
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 4 cut(s) 44, 761, 855, 1023
TspGWI ACGGA 2 cut(s) 95, 997
TspRI CASTG 4 cut(s) 139, 291, 880, 982
Van91I CCANNNNNTGG 1 cut(s) 227
VpaK11BI GGWCC 2 cut(s) 129, 161
XagI CCTNNNNNAGG 2 cut(s) 147, 731
XapI RAATTY 4 cut(s) 68, 383, 1097, 1223
XceI RCATGY 3 cut(s) 862, 1180, 1198
XcmI CCANNNNNNNNNTGG 1 cut(s) 1129
XmiI GTMKAC 2 cut(s) 201, 863
XspI CTAG 4 cut(s) 5, 662, 1173, 1214
Zsp2I ATGCAT 1 cut(s) 910
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.