Rmu_sc0008601.1_g000002

SAM dependent carboxyl methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008601.1
OG0000342
Physical Location & Seq
Reverse (-)
15811 .. 18174
2364 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008601.1_g000002.1.cds

Sequence Viewer

Length: 657 bp
atgaaaatcccagctttgatcatattggtggaatgcctgcaggttccaaaaggtttggtaacaaaaggaggactcaacgagggaaacatttgcacagccaagacaagcccaccttctgtgtttaatgaatactttgagcaatttaaaaacgacttcacagtgtttctaaggtctcgtgcagaagagttggtccctcagggtagaatggtcctcacaatcagggggagcataaacagtcatgaacccctctctatattagaatttcttggattgaaaatcaatgatatggttttagagggattgattgaaaagcaaaacttagactacttcaatattccatactttgaacctacaatggaggaactgatggagctgatcgagaccgaaggatcctttaggttgcatgaccatcaagtttttaaacatgattgggactcttttataaaggaagctgatagtggtctcgataagaaagcaagggcgggaatactctccactcacattaggtctgtggtggagcctcttctggtcagtcactttggagagggagtcatggaagatttgtttcgcaggtatgaaaaagatgttcttgatcacatggaaaaggagaagtgccagtctatagatatagttctatcgttgacaaaggagtgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00592 ko01110 map00592 map01110
Pfam Domains
Protein Families
Methyltransf_7

Protein Analysis

218

Amino Acids

24.96

Weight (kDa)

5.07

Isoelectric Point (pI)

50.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000342)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G14060 AT2G14060 AT3G11480 AT3G21950 AT3G21950 AT5G04370 AT5G04370 AT5G04370 AT5G04380 AT5G04380 AT5G04380 AT5G38020 AT5G38020 AT5G66430
fragaria_vesca FvH4_2g09290 FvH4_2g09290 FvH4_2g09310 FvH4_3g03130
malus_domestica MD10G1071000.v1.1 MD10G1071200.v1.1 MD10G1071500.v1.1 MD10G1218400.v1.1
prunus_persica Prupe.8G092700_v2.0.a1 Prupe.8G092800_v2.0.a1 Prupe.8G092900_v2.0.a1 Prupe.8G092900_v2.0.a1 Prupe.8G093000_v2.0.a1 Prupe.8G093100_v2.0.a1 Prupe.8G093200_v2.0.a1 Prupe.8G093500_v2.0.a1 Prupe.8G093500_v2.0.a1 Prupe.8G093600_v2.0.a1
pyrus_communis pycom10g05660 pycom10g05680 pycom10g18420
rosa_chinensis RchiOBHm_Chr1g0324421 RchiOBHm_Chr1g0324461 RchiOBHm_Chr6g0265311 RchiOBHm_Chr6g0265321 RchiOBHm_Chr6g0265361 RchiOBHm_Chr6g0265391 RchiOBHm_Chr6g0265411
rosa_laevigata RLG00000014186 RLG00000014191 RLG00000014195 RLG00000014197 RLG00000025381 RLG00000030199
rosa_multiflora Rmu_co8237181.1_g000001 Rmu_sc0001780.1_g000008 Rmu_sc0001803.1_g000020 Rmu_sc0002550.1_g000004 Rmu_sc0004082.1_g000012 Rmu_sc0008601.1_g000002 Rmu_sc0011954.1_g000001 Rmu_sc0013000.1_g000001 Rmu_sc0016482.1_g000001 Rmu_sc0018713.1_g000002 Rmu_ssc0000066.1_g000015
rosa_roxburghii Rroxscaffold_159G00432720 Rroxscaffold_159G00432790 Rroxscaffold_159G00432850 Rroxscaffold_175G00432320 Rroxscaffold_175G00432340 Rroxscaffold_175G00432350 Rroxscaffold_175G00432360 Rroxscaffold_2G00105600 Rroxscaffold_2G00105660 Rroxscaffold_4G00325530 Rroxscaffold_4G00325600 Rroxscaffold_4G00325670 Rroxscaffold_6G00424510 Rroxscaffold_7G00202680 Rroxscaffold_7G00202760 Rroxscaffold_7G00202800 Rroxscaffold_7G00202850
rosa_rugosa Rorug01G0045900 Rorug01G0046000 Rorug02G0355000 Rorug02G0355300 Rorug03G0004200 Rorug06G0016700 Rorug06G0016700 Rorug06G0016800 Rorug06G0017100
rosa_samantha Rh1AG061600 Rh1AG061700 Rh1BG052400 Rh1CG063500 Rh1CG063900 Rh1CG064100 Rh2BG415800 Rh3DG067100 Rh6AG138200 Rh6AG138400 Rh6AG138800 Rh6BG137100 Rh6BG137200 Rh6BG137600 Rh6DG121600 Rh6DG121700 Rh6DG121900
rosa_wichuraiana Rw1G005230 Rw1G005470 Rw2G033110 Rw6G011920 Rw6G011940 Rw6G011950 Rw6G011970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 443
Acc36I ACCTGC 2 cut(s) 31, 561
AciI CCGC 1 cut(s) 482
AclWI GGATC 2 cut(s) 384, 397
AcsI RAATTY 1 cut(s) 260
AgsI TTSAA 4 cut(s) 274, 308, 331, 347
AluBI AGCT 3 cut(s) 14, 373, 452
AluI AGCT 3 cut(s) 14, 373, 452
Alw26I GTCTC 3 cut(s) 177, 374, 467
AlwI GGATC 2 cut(s) 384, 397
ApoI RAATTY 1 cut(s) 260
AspS9I GGNCC 2 cut(s) 190, 208
AvaII GGWCC 2 cut(s) 190, 208
AxyI CCTNAGG 1 cut(s) 195
BamHI GGATCC 1 cut(s) 389
BauI CACGAG 1 cut(s) 174
BccI CCATC 2 cut(s) 361, 417
BclI TGATCA 2 cut(s) 18, 592
BcoDI GTCTC 3 cut(s) 177, 374, 467
BfmI CTRYAG 2 cut(s) 38, 621
BfuAI ACCTGC 2 cut(s) 31, 561
Bme18I GGWCC 2 cut(s) 190, 208
BmgT120I GGNCC 2 cut(s) 190, 208
BmiI GGNNCC 4 cut(s) 45, 192, 391, 519
BsaI GGTCTC 3 cut(s) 177, 374, 467
BsaXI ACNNNNNCTCC 2 cut(s) 534, 564
Bse1I ACTGG 1 cut(s) 616
Bse21I CCTNAGG 1 cut(s) 195
BseMII CTCAG 1 cut(s) 209
BseNI ACTGG 1 cut(s) 616
BseYI CCCAGC 1 cut(s) 10
BsgI GTGCAG 1 cut(s) 198
BslFI GGGAC 2 cut(s) 176, 446
BsmAI GTCTC 3 cut(s) 177, 374, 467
BsmFI GGGAC 2 cut(s) 176, 446
BsmI GAATGC 1 cut(s) 38
Bso31I GGTCTC 3 cut(s) 177, 374, 467
Bsp143I GATC 4 cut(s) 18, 375, 389, 592
BspACI CCGC 1 cut(s) 482
BspCNI CTCAG 1 cut(s) 208
BspHI TCATGA 1 cut(s) 238
BspLI GGNNCC 4 cut(s) 45, 192, 391, 519
BspMAI CTGCAG 1 cut(s) 42
BspMI ACCTGC 2 cut(s) 31, 561
BspPI GGATC 2 cut(s) 384, 397
BspTNI GGTCTC 3 cut(s) 177, 374, 467
BsrI ACTGG 1 cut(s) 616
BssMI GATC 4 cut(s) 18, 375, 389, 592
BssSI CACGAG 1 cut(s) 174
Bst2BI CACGAG 1 cut(s) 174
Bst4CI ACNGT 2 cut(s) 160, 236
Bst6I CTCTTC 2 cut(s) 177, 528
BstC8I GCNNGC 1 cut(s) 38
BstDEI CTNAG 3 cut(s) 167, 195, 319
BstKTI GATC 4 cut(s) 21, 378, 392, 595
BstMAI GTCTC 3 cut(s) 177, 374, 467
BstMBI GATC 4 cut(s) 18, 375, 389, 592
BstSFI CTRYAG 2 cut(s) 38, 621
BstX2I RGATCY 1 cut(s) 389
BstYI RGATCY 1 cut(s) 389
Bsu36I CCTNAGG 1 cut(s) 195
BtsIMutI CAGTG 1 cut(s) 165
BveI ACCTGC 2 cut(s) 31, 561
Cac8I GCNNGC 1 cut(s) 38
CciI TCATGA 1 cut(s) 238
Cfr13I GGNCC 2 cut(s) 190, 208
CviAII CATG 5 cut(s) 239, 404, 425, 553, 598
CviJI RGCY 6 cut(s) 14, 98, 108, 373, 452, 520
CviKI_1 RGCY 6 cut(s) 14, 98, 108, 373, 452, 520
DdeI CTNAG 3 cut(s) 167, 195, 319
DpnI GATC 4 cut(s) 20, 377, 391, 594
DpnII GATC 4 cut(s) 18, 375, 389, 592
DraI TTTAAA 2 cut(s) 145, 421
Eam1104I CTCTTC 2 cut(s) 177, 528
EarI CTCTTC 2 cut(s) 177, 528
Eco31I GGTCTC 3 cut(s) 177, 374, 467
Eco47I GGWCC 2 cut(s) 190, 208
Eco81I CCTNAGG 1 cut(s) 195
FaeI CATG 5 cut(s) 242, 407, 428, 556, 601
FalI AAGNNNNNCTT 6 cut(s) 97, 129, 302, 334, 573, 605
FaqI GGGAC 2 cut(s) 176, 446
FatI CATG 5 cut(s) 238, 403, 424, 552, 597
FauI CCCGC 1 cut(s) 475
FbaI TGATCA 2 cut(s) 18, 592
GsaI CCCAGC 1 cut(s) 14
Hin1II CATG 5 cut(s) 242, 407, 428, 556, 601
HincII GTYRAC 1 cut(s) 642
HindII GTYRAC 1 cut(s) 642
HinfI GANTC 3 cut(s) 72, 434, 549
Hpy166II GTNNAC 1 cut(s) 642
Hpy188III TCNNGA 4 cut(s) 239, 379, 464, 590
Hpy8I GTNNAC 1 cut(s) 642
HpyAV CCTTC 2 cut(s) 123, 380
HpyCH4III ACNGT 2 cut(s) 160, 236
HpyCH4V TGCA 4 cut(s) 40, 93, 179, 403
HpyF3I CTNAG 3 cut(s) 167, 195, 319
Hsp92II CATG 5 cut(s) 242, 407, 428, 556, 601
Ksp22I TGATCA 2 cut(s) 18, 592
Kzo9I GATC 4 cut(s) 18, 375, 389, 592
LmnI GCTCC 3 cut(s) 225, 370, 517
LpnPI CCDG 8 cut(s) 24, 26, 50, 182, 205, 512, 556, 629
MaeIII GTNAC 2 cut(s) 58, 533
MalI GATC 4 cut(s) 20, 377, 391, 594
MboI GATC 4 cut(s) 18, 375, 389, 592
MboII GAAGA 3 cut(s) 194, 515, 569
MflI RGATCY 1 cut(s) 389
MluCI AATT 2 cut(s) 140, 260
MlyI GAGTC 3 cut(s) 66, 428, 558
MnlI CCTC 9 cut(s) 62, 73, 204, 221, 257, 289, 352, 531, 538
MseI TTAA 3 cut(s) 123, 144, 420
MslI CAYNNNNRTG 1 cut(s) 26
Mva1269I GAATGC 1 cut(s) 38
NdeII GATC 4 cut(s) 18, 375, 389, 592
NlaIII CATG 5 cut(s) 242, 407, 428, 556, 601
NlaIV GGNNCC 4 cut(s) 45, 192, 391, 519
NmuCI GTSAC 1 cut(s) 533
PagI TCATGA 1 cut(s) 238
PctI GAATGC 1 cut(s) 38
PleI GAGTC 3 cut(s) 66, 428, 557
PpsI GAGTC 3 cut(s) 66, 428, 557
PsiI TTATAA 1 cut(s) 443
PspFI CCCAGC 1 cut(s) 10
PspN4I GGNNCC 4 cut(s) 45, 192, 391, 519
PspPI GGNCC 2 cut(s) 190, 208
PstI CTGCAG 1 cut(s) 42
PsuI RGATCY 1 cut(s) 389
RseI CAYNNNNRTG 1 cut(s) 26
SaqAI TTAA 3 cut(s) 123, 144, 420
Sau3AI GATC 4 cut(s) 18, 375, 389, 592
Sau96I GGNCC 2 cut(s) 190, 208
SbfI CCTGCAGG 1 cut(s) 42
SchI GAGTC 3 cut(s) 66, 428, 558
SdaI CCTGCAGG 1 cut(s) 42
SfcI CTRYAG 2 cut(s) 38, 621
SinI GGWCC 2 cut(s) 190, 208
SmiMI CAYNNNNRTG 1 cut(s) 26
Sse8387I CCTGCAGG 1 cut(s) 42
Sse9I AATT 2 cut(s) 140, 260
SsiI CCGC 1 cut(s) 482
SspI AATATT 1 cut(s) 334
TaaI ACNGT 2 cut(s) 160, 236
TaqI TCGA 2 cut(s) 378, 465
TaqII GACCGA 1 cut(s) 398
TasI AATT 2 cut(s) 140, 260
Tru1I TTAA 3 cut(s) 123, 144, 420
Tru9I TTAA 3 cut(s) 123, 144, 420
TscAI CASTG 1 cut(s) 165
TseFI GTSAC 1 cut(s) 533
Tsp45I GTSAC 1 cut(s) 533
TspDTI ATGAA 4 cut(s) 17, 141, 255, 591
TspRI CASTG 1 cut(s) 165
VpaK11BI GGWCC 2 cut(s) 190, 208
XapI RAATTY 1 cut(s) 260
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.