Rmu_ssc0000018.1_g000023

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000018.1
Physical Location & Seq
Reverse (-)
81589 .. 85299
3711 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000018.1_g000023.1.cds

Sequence Viewer

Length: 3711 bp
atggagtctttgattgtatctccgctggtagaggtgctctttggaaggttgactgccactgttgttggtcaactgcgaactcacagagggttcaagagggaggtcgagaagatgcaggagacgttaccggtgattcaagcggtgatagaagatgcagaggagcagcagaggaaaaataagagggtgaggatttggctggcaaagctcaaagacgtcgcagttgatgctgatgatctgcttgatgaggttgccaccctagttctgcgcaagcatttaatgaaagaggaattttacgggtcatatagtggcagcctcatggagctcgcactacagatctatcgcactgagaacagcataagtttcgtcacacgtaactaccaaaatcaattttttgagcagcataagtttcattcacggtcgaatctgaacacgaaggtgagaaagatcagagagcggacaaagtatgagtttaggaaaactttcttcactcttgaatcgaattctacttaccgtaagaagtcacgcaaactaagggagcttcgtgcaagattggatgatgtagccaaggaaatgtctagtttccagttcaaagaaactcagtcgtatggacggtcaagtacaatggagagacgcgaaactggaccctctgtcaatgagtcaaaggtttatggcagggaagaggatgtggataagattgtgaggatgctattgtcttccagtagtggtcctgaagttgcagtaattcccattgttagcgttggagggatggggaaaacaacactcgctcagttagtctacaatgatccgagggttacaaaccactttcaatctttgatgtgggtgtctgtcaatgataattttaacccagcaaggatcataaatcaaatgttgagttatgtcggaaaaggcagccatgactcgtttcagattggggtgctgcaatgtcaattgaaagaatccttactgggaagaagatatttgatagtgctcgatgatgtgtggaatgaggatccagatgaatgggataaagtaatgaatccattgaaaggctccgctggtggaagtaaaattatactaaccacccggaataaggcggttgcagccataactagcacatctcccccttttcatttggaaccactaagaaaagaagaatgctggaagttgttcaagcaccgagcctttgcagatggaacagagcatgattttccaagcttactgcacattggtgagcaaatagtagacaagtgcaaaggcgtcccattggttgcaaatattcttggaagcatgctgcaccgtaaaagagaagaaagcgagtggttacatgtgcaaaggagtgaactagggagtattgatgcaggggaaagcagaattctgtctatcttaagggtaagttacaatcgtttgccttcgcatctgaaagcttgctttgcatattgttcagtattcccaaagaattatgagattaataaggaaaagttgatccatcaatggctcgcacatggcttaattcctcatattggaaactcttcagttaggccagaggacattggcaatgagtattttaacaatttatcatcaatgtctttcttccaagaaataagaaaatatgatgacagaggtatggcagaatttaaaatgcatgatcatattaatgatcttgcaaaatctgttgccggagaggaatacttgactctaggacaggaaaatgtgcactatagtctctcaaagacatgtcatgcgtcagttgtatgcagttctagctctgctttgatccctgaagccttgtgtgaagcaaagagattgcgaaccctcaatttcctgtcgccaagagaggattatgcggaagccattccaaccatactagcaacttttaaacatctcagaatgctgaatttcagtggatctggaattaagagtctccacagagagattggtgggctactatccttgcggtatcttgatctatcaaatactctcctagagacgatgccagcaactatctgtgatctgtgcaatttgcagaccctgaatctctcaagttgtattgagctcaaggagttaccaagtggtacttccaagttaataaatctgagacatcttaacatagatgattgtccaagacttgcgagaatgcccccatcaatggaaactttacaacaacttcaaactttgccagtatatatcgtcggccccggctttgaaacttctatttttcagctctcagcaatgaaaaatctacgagggaagttaaaaatcaaatgtctggaggaggctataattccacttgggaacgacgtgattaaagattggatgaaaacgaaagagtttcattcgttggaactgttgtggcaaaatgatgggggcaagctcgatcataatagatataggccagctggcaggcaagttgatgatagaactcattttagtctggtagattctttgactgtatctccctttataagaaagttgtcaataaatggttattctggaaccaggttcccagatgagatgagttggcctcaaaacttgactgagctaaacataattaattgcagaagatgtgaaagtcttcctccactcggtcaacttcctgtcctcaagatcctcaacatccaaggaatggattctgttgtgcacattggtgtcgaattctcaggtgaaggagacagaccatttagttctcttaaagagctatccctcatagactttccagaattaagaacttggagtagtatcaattccacagaagtgtttacttgtctgaaaaaacttgttatcacaaattgtccctttttgacaaccatgccatggtttccatatctccgagacttgaagctgaggaagtgcgtgcagcgtgaccaaatggtaatatggtcagcatcagagcttactacactctctactcttgtcattgactcctttccactgatgagttttctaccaaaaaaattgctgcaaaacaattcagatctgatatcattaactgttacttcctgccccaagattggctcactacctgaaaatctgggaatcctcactgctctgaaatcgttgaaaattggatggtgtgacgagttagagactttgccaagtggactaaagtacctcacttcactggagaacttggaaatcgttgaatgtcctagtataatctgtttgccagaggaaggcatggaaggcttgtgctcacttcggtcattttcaattgagaactgtccgagcttaacatctttgcctatgggtatgaaatacctcacatctcttgagaacctcacggttatgtttttaaatctggttcatctgccagagacttttcaatacctcttggcacttagaagcctgacaattataggctgtccagagcttataagtctgccagtgggactgcaacttgtccagaatttacaaatcttggaaatccatagctgcccaaaactaatggaattgccagagtgggtggagcatcttgtttcacttcgatctttgaaaatctcagactgcacaaaaatagagttcttgccaaaaggtctacaatgtcttggtgggctccaatacctgtccataagagactgtcctgtccttgagaagcgctgcgagagcgaaactggtgaggactggcagaagatatctcatattctatataaacatgttggatcatcagcagtgcagcacaggcaagacattgcatccacctcacagaatccttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

1236

Amino Acids

140.36

Weight (kDa)

7.33

Isoelectric Point (pI)

49.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000400)

Species Orthologous Gene IDs
malus_domestica MD05G1050700.v1.1 MD05G1050800.v1.1 MD08G1110700.v1.1 MD15G1090000.v1.1 MD15G1090100.v1.1 MD15G1090300.v1.1
prunus_persica Prupe.1G541300_v2.0.a1 Prupe.1G541300_v2.0.a1 Prupe.8G077100_v2.0.a1 Prupe.8G077200_v2.0.a1 Prupe.8G077500_v2.0.a1 Prupe.8G077600_v2.0.a1 Prupe.8G211300_v2.0.a1
pyrus_communis pycom05g04280 pycom08g09220 pycom15g08440
rosa_chinensis RchiOBHm_Chr1g0348461 RchiOBHm_Chr1g0348561 RchiOBHm_Chr6g0269201 RchiOBHm_Chr6g0269411 RchiOBHm_Chr6g0269421 RchiOBHm_Chr6g0269431 RchiOBHm_Chr7g0232901 RchiOBHm_Chr7g0232931 RchiOBHm_Chr7g0232961 RchiOBHm_Chr7g0232971
rosa_laevigata RLG00000001310
rosa_multiflora Rmu_sc0000091.1_g000001 Rmu_sc0000091.1_g000002 Rmu_sc0000091.1_g000008 Rmu_sc0000743.1_g000003 Rmu_sc0000743.1_g000004 Rmu_sc0005353.1_g000002 Rmu_sc0008668.1_g000002 Rmu_sc0015938.1_g000001 Rmu_ssc0000018.1_g000023 Rmu_ssc0000291.1_g000019 Rmu_ssc0000291.1_g000020 Rmu_ssc0000291.1_g000026 Rmu_ssc0000291.1_g000027
rosa_roxburghii Rroxscaffold_3G00227800 Rroxscaffold_3G00227820 Rroxscaffold_4G00306930 Rroxscaffold_4G00306950 Rroxscaffold_7G00198730
rosa_rugosa Rorug01G0194900 Rorug01G0194900 Rorug01G0195000 Rorug01G0195100 Rorug06G0045900 Rorug06G0046100 Rorug06G0047500 Rorug06G0047500 Rorug06G0047600 Rorug06G0047700 Rorug07G0276400 Rorug07G0276600 Rorug07G0276800.1 Rorug07G0276900
rosa_samantha Rh1AG213000 Rh1AG213100 Rh1BG179500 Rh1CG197300 Rh1CG197400 Rh1DG209600 Rh6AG166200 Rh6AG168000 Rh6AG168100 Rh6AG168200 Rh6BG171700 Rh6BG171800 Rh6BG173500 Rh6CG165300 Rh6CG167500 Rh6CG167600 Rh6DG156900 Rh6DG159400 Rh6DG159500 Rh6DG159600 Rh7AG431600 Rh7AG431700 Rh7AG431800 Rh7AG432100 Rh7AG432200 Rh7BG404700 Rh7BG404800 Rh7BG404900 Rh7BG405000 Rh7CG450600 Rh7CG450700 Rh7CG450800 Rh7CG451200 Rh7DG421300
rosa_wichuraiana Rw0G004710 Rw0G010410 Rw1G018020 Rw1G018040 Rw6G014350 Rw6G014450 Rw6G014470 Rw7G035660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 2462, 3371
AasI GACNNNNNNGTC 1 cut(s) 3578
AatII GACGTC 1 cut(s) 216
Acc16I TGCGCA 1 cut(s) 266
AccB7I CCANNNNNTGG 2 cut(s) 2623, 2811
AccBSI CCGCTC 1 cut(s) 454
AccI GTMKAC 3 cut(s) 795, 1242, 3532
AccII CGCG 1 cut(s) 633
AciI CCGC 7 cut(s) 23, 140, 454, 1053, 1094, 1844, 1954
AclWI GGATC 9 cut(s) 797, 881, 1004, 1017, 1477, 1768, 1912, 2599, 3664
AcsI RAATTY 7 cut(s) 287, 499, 1371, 1631, 1894, 2651, 3403
AcuI CTGAAG 3 cut(s) 750, 1515, 1800
AcyI GRCGYC 2 cut(s) 213, 1257
AfaI GTAC 3 cut(s) 619, 2074, 3107
AfeI AGCGCT 1 cut(s) 3593
AfiI CCNNNNNNNGG 9 cut(s) 1046, 1090, 1520, 2146, 2582, 2623, 2811, 3008, 3170
AflII CTTAAG 1 cut(s) 1384
AflIII ACRYGT 4 cut(s) 368, 1324, 1733, 3649
AgeI ACCGGT 1 cut(s) 127
AhdI GACNNNNNGTC 1 cut(s) 647
AjiI CACGTC 1 cut(s) 2299
AjnI CCWGG 1 cut(s) 2495
AjuI GAANNNNNNNTTGG 2 cut(s) 2059, 2091
AleI CACNNNNGTG 4 cut(s) 434, 1227, 2643, 2750
Alw21I GWGCWC 7 cut(s) 39, 324, 990, 1716, 2055, 2640, 3191
Alw44I GTGCAC 2 cut(s) 1712, 2636
AlwI GGATC 9 cut(s) 797, 881, 1004, 1017, 1477, 1768, 1912, 2599, 3664
AlwNI CAGNNNCTG 1 cut(s) 2029
Aor51HI AGCGCT 1 cut(s) 3593
AoxI GGCC 4 cut(s) 1538, 2191, 2390, 2519
ApaLI GTGCAC 2 cut(s) 1712, 2636
ApoI RAATTY 7 cut(s) 287, 499, 1371, 1631, 1894, 2651, 3403
AseI ATTAAT 3 cut(s) 1467, 1653, 2550
AsiGI ACCGGT 1 cut(s) 127
Asp700I GAANNNNTTC 6 cut(s) 479, 1166, 1528, 1851, 2571, 2626
AspLEI GCGC 2 cut(s) 267, 3594
AspS9I GGNCC 3 cut(s) 641, 725, 2192
AsuC2I CCSGG 2 cut(s) 1084, 2196
AsuHPI GGTGA 7 cut(s) 142, 154, 196, 448, 1241, 2672, 3623
AvaII GGWCC 2 cut(s) 641, 725
BaeGI GKGCMC 2 cut(s) 1716, 2640
BaeI ACNNNNGTAYC 2 cut(s) 3089, 3122
BamHI GGATCC 1 cut(s) 1009
BanII GRGCYC 3 cut(s) 324, 2055, 3552
BbsI GAAGAC 2 cut(s) 705, 2564
Bbv12I GWGCWC 7 cut(s) 39, 324, 990, 1716, 2055, 2640, 3191
BbvCI CCTCAGC 1 cut(s) 2840
BccI CCATC 6 cut(s) 760, 1184, 1494, 2149, 2354, 3060
BcgI CGANNNNNNTGC 2 cut(s) 343, 377
BciT130I CCWGG 1 cut(s) 2497
BclI TGATCA 1 cut(s) 1645
BcnI CCSGG 2 cut(s) 1084, 2196
BfaI CTAG 9 cut(s) 257, 576, 1110, 1343, 1697, 1761, 1865, 1982, 3147
BfmI CTRYAG 2 cut(s) 329, 1717
BfoI RGCGCY 1 cut(s) 3595
BfrI CTTAAG 1 cut(s) 1384
BglII AGATCT 2 cut(s) 333, 2971
Bme1390I CCNGG 3 cut(s) 1084, 2196, 2497
Bme18I GGWCC 2 cut(s) 641, 725
BmeRI GACNNNNNGTC 1 cut(s) 647
BmgBI CACGTC 1 cut(s) 2299
BmgT120I GGNCC 3 cut(s) 641, 725, 2192
BmiI GGNNCC 8 cut(s) 643, 1011, 1051, 1137, 2194, 2494, 2501, 3551
BmrFI CCNGG 3 cut(s) 1084, 2196, 2497
BmrI ACTGGG 1 cut(s) 974
BmuI ACTGGG 1 cut(s) 974
BpiI GAAGAC 2 cut(s) 705, 2564
BplI GAGNNNNNCTC 2 cut(s) 2506, 2538
BpmI CTGGAG 2 cut(s) 2288, 3140
Bpu10I CCTNAGC 1 cut(s) 2840
BpuEI CTTGAG 5 cut(s) 2023, 2039, 2585, 3287, 3605
BpuMI CCSGG 2 cut(s) 1084, 2196
BsaAI YACGTR 1 cut(s) 371
BsaHI GRCGYC 2 cut(s) 213, 1257
BsaJI CCNNGG 5 cut(s) 564, 806, 2194, 2617, 2810
BsaWI WCCGGW 1 cut(s) 127
BsaXI ACNNNNNCTCC 2 cut(s) 2437, 2467
Bsc4I CCNNNNNNNGG 9 cut(s) 1046, 1090, 1520, 2146, 2582, 2623, 2811, 3008, 3170
Bse118I RCCGGY 1 cut(s) 127
Bse1I ACTGG 9 cut(s) 583, 643, 717, 969, 2177, 3123, 3380, 3613, 3623
Bse3DI GCAATG 4 cut(s) 947, 1561, 2235, 3684
BseBI CCWGG 1 cut(s) 2497
BseDI CCNNGG 5 cut(s) 564, 806, 2194, 2617, 2810
BseGI GGATG 8 cut(s) 559, 688, 708, 771, 2319, 2613, 3071, 3689
BseLI CCNNNNNNNGG 9 cut(s) 1046, 1090, 1520, 2146, 2582, 2623, 2811, 3008, 3170
BseMI GCAATG 4 cut(s) 947, 1561, 2235, 3684
BseNI ACTGG 9 cut(s) 583, 643, 717, 969, 2177, 3123, 3380, 3613, 3623
BseRI GAGGAG 2 cut(s) 173, 2285
BseSI GKGCMC 2 cut(s) 1716, 2640
BseYI CCCAGC 1 cut(s) 865
BsgI GTGCAG 5 cut(s) 1205, 1277, 2873, 3487, 3689
Bsh1236I CGCG 1 cut(s) 633
Bsh1285I CGRYCG 1 cut(s) 419
BshFI GGCC 4 cut(s) 1540, 2193, 2392, 2521
BshTI ACCGGT 1 cut(s) 127
BsiEI CGRYCG 1 cut(s) 419
BsiHKAI GWGCWC 7 cut(s) 39, 324, 990, 1716, 2055, 2640, 3191
BsiSI CCGG 4 cut(s) 128, 1084, 1677, 2196
BslFI GGGAC 3 cut(s) 1244, 2775, 3399
BslI CCNNNNNNNGG 9 cut(s) 1046, 1090, 1520, 2146, 2582, 2623, 2811, 3008, 3170
BsmBI CGTCTC 3 cut(s) 113, 622, 1979
BsmFI GGGAC 3 cut(s) 1244, 2775, 3399
BsmI GAATGC 3 cut(s) 1160, 1893, 2139
BsnI GGCC 4 cut(s) 1540, 2193, 2392, 2521
Bsp1286I GDGCHC 8 cut(s) 39, 324, 990, 1716, 2055, 2640, 3191, 3552
Bsp19I CCATGG 1 cut(s) 2810
BspACI CCGC 7 cut(s) 23, 140, 454, 1053, 1094, 1844, 1954
BspANI GGCC 4 cut(s) 1540, 2193, 2392, 2521
BspFNI CGCG 1 cut(s) 633
BspLI GGNNCC 8 cut(s) 643, 1011, 1051, 1137, 2194, 2494, 2501, 3551
BspPI GGATC 9 cut(s) 797, 881, 1004, 1017, 1477, 1768, 1912, 2599, 3664
BspTI CTTAAG 1 cut(s) 1384
BsrBI CCGCTC 1 cut(s) 454
BsrDI GCAATG 4 cut(s) 947, 1561, 2235, 3684
BsrFI RCCGGY 1 cut(s) 127
BsrI ACTGG 9 cut(s) 583, 643, 717, 969, 2177, 3123, 3380, 3613, 3623
BssAI RCCGGY 1 cut(s) 127
BssECI CCNNGG 5 cut(s) 564, 806, 2194, 2617, 2810
BssNI GRCGYC 2 cut(s) 213, 1257
BssT1I CCWWGG 3 cut(s) 564, 2617, 2810
Bst2UI CCWGG 1 cut(s) 2497
Bst6I CTCTTC 2 cut(s) 672, 1534
BstACI GRCGYC 2 cut(s) 213, 1257
BstAFI CTTAAG 1 cut(s) 1384
BstAPI GCANNNNNTGC 1 cut(s) 224
BstBAI YACGTR 1 cut(s) 371
BstDSI CCRYGG 1 cut(s) 2810
BstF5I GGATG 8 cut(s) 559, 688, 708, 771, 2319, 2613, 3071, 3689
BstFNI CGCG 1 cut(s) 633
BstH2I RGCGCY 1 cut(s) 3595
BstHHI GCGC 2 cut(s) 267, 3594
BstMCI CGRYCG 1 cut(s) 419
BstMWI GCNNNNNNNGC 8 cut(s) 202, 224, 1100, 1430, 1761, 3180, 3600, 3676
BstNI CCWGG 1 cut(s) 2497
BstNSI RCATGY 4 cut(s) 1291, 1328, 1737, 3653
BstSCI CCNGG 3 cut(s) 1082, 2194, 2495
BstSFI CTRYAG 2 cut(s) 329, 1717
BstSLI GKGCMC 2 cut(s) 1716, 2640
BstUI CGCG 1 cut(s) 633
BstV2I GAAGAC 2 cut(s) 705, 2564
BstX2I RGATCY 5 cut(s) 333, 1009, 1904, 2604, 2971
BstXI CCANNNNNNTGG 1 cut(s) 1020
BstYI RGATCY 5 cut(s) 333, 1009, 1904, 2604, 2971
BsuRI GGCC 4 cut(s) 1540, 2193, 2392, 2521
BtgI CCRYGG 1 cut(s) 2810
BtrI CACGTC 1 cut(s) 2299
BtsCI GGATG 8 cut(s) 559, 688, 708, 771, 2319, 2613, 3071, 3689
BtsI GCAGTG 2 cut(s) 3039, 3672
BtsIMutI CAGTG 8 cut(s) 57, 342, 1906, 2927, 3039, 3116, 3387, 3672
CaiI CAGNNNCTG 1 cut(s) 2029
CfoI GCGC 2 cut(s) 267, 3594
Cfr10I RCCGGY 1 cut(s) 127
Cfr13I GGNCC 3 cut(s) 641, 725, 2192
CseI GACGC 3 cut(s) 639, 1246, 1731
CsiI ACCWGGT 1 cut(s) 2495
Csp6I GTAC 3 cut(s) 618, 2073, 3106
CspAI ACCGGT 1 cut(s) 127
CspCI CAANNNNNGTGG 2 cut(s) 46, 81
CviQI GTAC 3 cut(s) 618, 2073, 3106
DraI TTTAAA 3 cut(s) 1636, 1876, 3291
DrdI GACNNNNNNGTC 1 cut(s) 3578
DriI GACNNNNNGTC 1 cut(s) 647
DseDI GACNNNNNNGTC 1 cut(s) 3578
Eam1104I CTCTTC 2 cut(s) 672, 1534
Eam1105I GACNNNNNGTC 1 cut(s) 647
EarI CTCTTC 2 cut(s) 672, 1534
Ecl136II GAGCTC 2 cut(s) 322, 2053
Eco130I CCWWGG 3 cut(s) 564, 2617, 2810
Eco24I GRGCYC 3 cut(s) 324, 2055, 3552
Eco32I GATATC 2 cut(s) 2979, 3630
Eco47I GGWCC 2 cut(s) 641, 725
Eco47III AGCGCT 1 cut(s) 3593
Eco53kI GAGCTC 2 cut(s) 322, 2053
Eco57I CTGAAG 3 cut(s) 750, 1515, 1800
EcoICRI GAGCTC 2 cut(s) 322, 2053
EcoRI GAATTC 3 cut(s) 499, 1371, 2651
EcoRII CCWGG 1 cut(s) 2495
EcoRV GATATC 2 cut(s) 2979, 3630
EcoT14I CCWWGG 3 cut(s) 564, 2617, 2810
EcoT22I ATGCAT 1 cut(s) 1644
EcoT38I GRGCYC 3 cut(s) 324, 2055, 3552
ErhI CCWWGG 3 cut(s) 564, 2617, 2810
Esp3I CGTCTC 3 cut(s) 113, 622, 1979
FalI AAGNNNNNCTT 2 cut(s) 2059, 2091
FaqI GGGAC 3 cut(s) 1244, 2775, 3399
FbaI TGATCA 1 cut(s) 1645
FblI GTMKAC 3 cut(s) 795, 1242, 3532
FokI GGATG 8 cut(s) 566, 695, 715, 778, 2326, 2600, 3078, 3676
FriOI GRGCYC 3 cut(s) 324, 2055, 3552
FspBI CTAG 9 cut(s) 257, 576, 1110, 1343, 1697, 1761, 1865, 1982, 3147
FspI TGCGCA 1 cut(s) 266
GlaI GCGC 2 cut(s) 266, 3593
GsaI CCCAGC 1 cut(s) 869
GsuI CTGGAG 2 cut(s) 2288, 3140
HaeII RGCGCY 1 cut(s) 3595
HaeIII GGCC 4 cut(s) 1540, 2193, 2392, 2521
HapII CCGG 4 cut(s) 128, 1084, 1677, 2196
HgaI GACGC 3 cut(s) 639, 1246, 1731
HhaI GCGC 2 cut(s) 267, 3594
Hin1I GRCGYC 2 cut(s) 213, 1257
Hin6I GCGC 2 cut(s) 265, 3592
HinP1I GCGC 2 cut(s) 265, 3592
HincII GTYRAC 3 cut(s) 51, 71, 2588
HindII GTYRAC 3 cut(s) 51, 71, 2588
HindIII AAGCTT 2 cut(s) 1213, 1422
HpaII CCGG 4 cut(s) 128, 1084, 1677, 2196
HphI GGTGA 7 cut(s) 142, 154, 196, 448, 1241, 2672, 3623
Hpy99I CGWCG 3 cut(s) 218, 2192, 2300
HpyAV CCTTC 6 cut(s) 39, 427, 1419, 2657, 3164, 3173
HpyCH4IV ACGT 4 cut(s) 122, 213, 370, 2298
HpyF10VI GCNNNNNNNGC 8 cut(s) 202, 224, 1100, 1430, 1761, 3180, 3600, 3676
HpySE526I ACGT 4 cut(s) 122, 213, 370, 2298
Hsp92I GRCGYC 2 cut(s) 213, 1257
HspAI GCGC 2 cut(s) 265, 3592
Ksp22I TGATCA 1 cut(s) 1645
LmnI GCTCC 6 cut(s) 160, 319, 535, 1055, 3463, 3555
MabI ACCWGGT 1 cut(s) 2495
MaeI CTAG 9 cut(s) 257, 576, 1110, 1343, 1697, 1761, 1865, 1982, 3147
MaeII ACGT 4 cut(s) 122, 213, 370, 2298
MbiI CCGCTC 1 cut(s) 454
MfeI CAATTG 2 cut(s) 947, 3207
MflI RGATCY 5 cut(s) 333, 1009, 1904, 2604, 2971
MhlI GDGCHC 8 cut(s) 39, 324, 990, 1716, 2055, 2640, 3191, 3552
MlyI GAGTC 6 cut(s) 14, 665, 911, 1687, 1927, 2912
MmeI TCCRAC 5 cut(s) 739, 880, 1880, 2319, 3634
Mph1103I ATGCAT 1 cut(s) 1644
MroXI GAANNNNTTC 6 cut(s) 479, 1166, 1528, 1851, 2571, 2626
MslI CAYNNNNRTG 6 cut(s) 434, 1227, 1653, 2643, 2750, 3281
MspA1I CMGCKG 3 cut(s) 25, 1055, 2396
MspCI CTTAAG 1 cut(s) 1384
MspI CCGG 4 cut(s) 128, 1084, 1677, 2196
MspR9I CCNGG 3 cut(s) 1084, 2196, 2497
MunI CAATTG 2 cut(s) 947, 3207
Mva1269I GAATGC 3 cut(s) 1160, 1893, 2139
MvaI CCWGG 1 cut(s) 2497
MvnI CGCG 1 cut(s) 633
MwoI GCNNNNNNNGC 8 cut(s) 202, 224, 1100, 1430, 1761, 3180, 3600, 3676
NciI CCSGG 2 cut(s) 1084, 2196
NcoI CCATGG 1 cut(s) 2810
NlaIV GGNNCC 8 cut(s) 643, 1011, 1051, 1137, 2194, 2494, 2501, 3551
NmuCI GTSAC 4 cut(s) 364, 519, 2858, 3071
NsbI TGCGCA 1 cut(s) 266
NsiI ATGCAT 1 cut(s) 1644
NspI RCATGY 4 cut(s) 1291, 1328, 1737, 3653
OliI CACNNNNGTG 4 cut(s) 434, 1227, 2643, 2750
PaeI GCATGC 1 cut(s) 1291
PciI ACATGT 3 cut(s) 1324, 1733, 3649
PctI GAATGC 3 cut(s) 1160, 1893, 2139
PdmI GAANNNNTTC 6 cut(s) 479, 1166, 1528, 1851, 2571, 2626
PflMI CCANNNNNTGG 2 cut(s) 2623, 2811
PinAI ACCGGT 1 cut(s) 127
PleI GAGTC 6 cut(s) 13, 664, 911, 1687, 1926, 2912
PpsI GAGTC 6 cut(s) 13, 664, 911, 1687, 1926, 2912
Ppu21I YACGTR 1 cut(s) 371
PscI ACATGT 3 cut(s) 1324, 1733, 3649
PshBI ATTAAT 3 cut(s) 1467, 1653, 2550
PsiI TTATAA 2 cut(s) 2462, 3371
Psp124BI GAGCTC 2 cut(s) 324, 2055
Psp6I CCWGG 1 cut(s) 2495
PspFI CCCAGC 1 cut(s) 865
PspGI CCWGG 1 cut(s) 2495
PspN4I GGNNCC 8 cut(s) 643, 1011, 1051, 1137, 2194, 2494, 2501, 3551
PspPI GGNCC 3 cut(s) 641, 725, 2192
PstNI CAGNNNCTG 1 cut(s) 2029
PsuI RGATCY 5 cut(s) 333, 1009, 1904, 2604, 2971
PvuII CAGCTG 1 cut(s) 2396
RsaI GTAC 3 cut(s) 619, 2074, 3107
RsaNI GTAC 3 cut(s) 618, 2073, 3106
RseI CAYNNNNRTG 6 cut(s) 434, 1227, 1653, 2643, 2750, 3281
SacI GAGCTC 2 cut(s) 324, 2055
Sau96I GGNCC 3 cut(s) 641, 725, 2192
SchI GAGTC 6 cut(s) 14, 665, 911, 1687, 1927, 2912
ScrFI CCNGG 3 cut(s) 1084, 2196, 2497
SduI GDGCHC 8 cut(s) 39, 324, 990, 1716, 2055, 2640, 3191, 3552
SexAI ACCWGGT 1 cut(s) 2495
SfcI CTRYAG 2 cut(s) 329, 1717
SinI GGWCC 2 cut(s) 641, 725
SmiMI CAYNNNNRTG 6 cut(s) 434, 1227, 1653, 2643, 2750, 3281
SmlI CTYRAG 6 cut(s) 1384, 2038, 2054, 2600, 3266, 3584
SmoI CTYRAG 6 cut(s) 1384, 2038, 2054, 2600, 3266, 3584
SphI GCATGC 1 cut(s) 1291
SsiI CCGC 7 cut(s) 23, 140, 454, 1053, 1094, 1844, 1954
SspI AATATT 1 cut(s) 1276
SspMI CTAG 9 cut(s) 257, 576, 1110, 1343, 1697, 1761, 1865, 1982, 3147
SstI GAGCTC 2 cut(s) 324, 2055
StyD4I CCNGG 3 cut(s) 1082, 2194, 2495
StyI CCWWGG 3 cut(s) 564, 2617, 2810
TaiI ACGT 4 cut(s) 125, 216, 373, 2301
TaqI TCGA 7 cut(s) 105, 419, 497, 990, 2373, 2649, 3481
TaqII GACCGA 2 cut(s) 2573, 3186
TatI WGTACW 1 cut(s) 617
TscAI CASTG 8 cut(s) 64, 349, 1906, 2934, 3046, 3123, 3387, 3672
TseFI GTSAC 4 cut(s) 364, 519, 2858, 3071
Tsp45I GTSAC 4 cut(s) 364, 519, 2858, 3071
TspRI CASTG 8 cut(s) 64, 349, 1906, 2934, 3046, 3123, 3387, 3672
Van91I CCANNNNNTGG 2 cut(s) 2623, 2811
Vha464I CTTAAG 1 cut(s) 1384
VneI GTGCAC 2 cut(s) 1712, 2636
VpaK11BI GGWCC 2 cut(s) 641, 725
VspI ATTAAT 3 cut(s) 1467, 1653, 2550
XapI RAATTY 7 cut(s) 287, 499, 1371, 1631, 1894, 2651, 3403
XceI RCATGY 4 cut(s) 1291, 1328, 1737, 3653
XcmI CCANNNNNNNNNTGG 1 cut(s) 1931
XmiI GTMKAC 3 cut(s) 795, 1242, 3532
XmnI GAANNNNTTC 6 cut(s) 479, 1166, 1528, 1851, 2571, 2626
XspI CTAG 9 cut(s) 257, 576, 1110, 1343, 1697, 1761, 1865, 1982, 3147
ZraI GACGTC 1 cut(s) 214
Zsp2I ATGCAT 1 cut(s) 1644
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.