Rh7AG432100

Belongs to the disease resistance NB-LRR family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0000400
Physical Location & Seq
Reverse (-)
58103559 .. 58103801
243 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG432100.1

Sequence Viewer

Length: 243 bp
ATGATTAAAGTGTGGATGAAAACTAAAGAGTTTTATTCATTGGAACTGTTGTGGCAAAATGATGATGGGGGCAAGCTAGATCAAAACAGATCTAGGCAAGCTGGCAGGCAAGTTGATGATAAAACTGATTTTACTCTAGTAGATTCTTTAACTGTATCTCCATTTGTAAGGATGTTGTCAATAAATGGTTATTCAGGAACAAAGTTCCCAGATGAGATGAGTTGGTCTCAGAAACTTGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03460 map03460
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

80

Amino Acids

9.32

Weight (kDa)

5.29

Isoelectric Point (pI)

37.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000400)

Species Orthologous Gene IDs
malus_domestica MD05G1050700.v1.1 MD05G1050800.v1.1 MD08G1110700.v1.1 MD15G1090000.v1.1 MD15G1090100.v1.1 MD15G1090300.v1.1
prunus_persica Prupe.1G541300_v2.0.a1 Prupe.1G541300_v2.0.a1 Prupe.8G077100_v2.0.a1 Prupe.8G077200_v2.0.a1 Prupe.8G077500_v2.0.a1 Prupe.8G077600_v2.0.a1 Prupe.8G211300_v2.0.a1
pyrus_communis pycom05g04280 pycom08g09220 pycom15g08440
rosa_chinensis RchiOBHm_Chr1g0348461 RchiOBHm_Chr1g0348561 RchiOBHm_Chr6g0269201 RchiOBHm_Chr6g0269411 RchiOBHm_Chr6g0269421 RchiOBHm_Chr6g0269431 RchiOBHm_Chr7g0232901 RchiOBHm_Chr7g0232931 RchiOBHm_Chr7g0232961 RchiOBHm_Chr7g0232971
rosa_laevigata RLG00000001310
rosa_multiflora Rmu_sc0000091.1_g000001 Rmu_sc0000091.1_g000002 Rmu_sc0000091.1_g000008 Rmu_sc0000743.1_g000003 Rmu_sc0000743.1_g000004 Rmu_sc0005353.1_g000002 Rmu_sc0008668.1_g000002 Rmu_sc0015938.1_g000001 Rmu_ssc0000018.1_g000023 Rmu_ssc0000291.1_g000019 Rmu_ssc0000291.1_g000020 Rmu_ssc0000291.1_g000026 Rmu_ssc0000291.1_g000027
rosa_roxburghii Rroxscaffold_3G00227800 Rroxscaffold_3G00227820 Rroxscaffold_4G00306930 Rroxscaffold_4G00306950 Rroxscaffold_7G00198730
rosa_rugosa Rorug01G0194900 Rorug01G0194900 Rorug01G0195000 Rorug01G0195100 Rorug06G0045900 Rorug06G0046100 Rorug06G0047500 Rorug06G0047500 Rorug06G0047600 Rorug06G0047700 Rorug07G0276400 Rorug07G0276600 Rorug07G0276800.1 Rorug07G0276900
rosa_samantha Rh1AG213000 Rh1AG213100 Rh1BG179500 Rh1CG197300 Rh1CG197400 Rh1DG209600 Rh6AG166200 Rh6AG168000 Rh6AG168100 Rh6AG168200 Rh6BG171700 Rh6BG171800 Rh6BG173500 Rh6CG165300 Rh6CG167500 Rh6CG167600 Rh6DG156900 Rh6DG159400 Rh6DG159500 Rh6DG159600 Rh7AG431600 Rh7AG431700 Rh7AG431800 Rh7AG432100 Rh7AG432200 Rh7BG404700 Rh7BG404800 Rh7BG404900 Rh7BG405000 Rh7CG450600 Rh7CG450700 Rh7CG450800 Rh7CG451200 Rh7DG421300
rosa_wichuraiana Rw0G004710 Rw0G010410 Rw1G018020 Rw1G018040 Rw6G014350 Rw6G014450 Rw6G014470 Rw7G035660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 76, 101
AluI AGCT 2 cut(s) 76, 101
Alw26I GTCTC 1 cut(s) 231
BccI CCATC 1 cut(s) 59
BcoDI GTCTC 1 cut(s) 231
BfaI CTAG 3 cut(s) 77, 93, 137
BglII AGATCT 1 cut(s) 89
BplI GAGNNNNNCTC 2 cut(s) 211, 243
BsaI GGTCTC 1 cut(s) 231
BsaXI ACNNNNNCTCC 2 cut(s) 142, 172
BseGI GGATG 2 cut(s) 21, 177
BseMII CTCAG 1 cut(s) 242
BsmAI GTCTC 1 cut(s) 231
Bso31I GGTCTC 1 cut(s) 231
Bsp143I GATC 2 cut(s) 79, 89
BspCNI CTCAG 1 cut(s) 241
BspTNI GGTCTC 1 cut(s) 231
BssMI GATC 2 cut(s) 79, 89
Bst4CI ACNGT 2 cut(s) 48, 154
BstC8I GCNNGC 4 cut(s) 74, 99, 103, 107
BstDEI CTNAG 1 cut(s) 228
BstF5I GGATG 2 cut(s) 21, 177
BstKTI GATC 2 cut(s) 82, 92
BstMAI GTCTC 1 cut(s) 231
BstMBI GATC 2 cut(s) 79, 89
BstX2I RGATCY 1 cut(s) 89
BstYI RGATCY 1 cut(s) 89
BtsCI GGATG 2 cut(s) 21, 177
Cac8I GCNNGC 4 cut(s) 74, 99, 103, 107
CviJI RGCY 2 cut(s) 76, 101
CviKI_1 RGCY 2 cut(s) 76, 101
DdeI CTNAG 1 cut(s) 228
DpnI GATC 2 cut(s) 81, 91
DpnII GATC 2 cut(s) 79, 89
Eco31I GGTCTC 1 cut(s) 231
FokI GGATG 2 cut(s) 28, 184
FspBI CTAG 3 cut(s) 77, 93, 137
HinfI GANTC 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 231
Hpy188III TCNNGA 1 cut(s) 195
HpyCH4III ACNGT 2 cut(s) 48, 154
HpyF3I CTNAG 1 cut(s) 228
Kzo9I GATC 2 cut(s) 79, 89
LpnPI CCDG 4 cut(s) 87, 91, 180, 222
MaeI CTAG 3 cut(s) 77, 93, 137
MalI GATC 2 cut(s) 81, 91
MboI GATC 2 cut(s) 79, 89
MflI RGATCY 1 cut(s) 89
MseI TTAA 2 cut(s) 6, 149
NdeII GATC 2 cut(s) 79, 89
PfeI GAWTC 1 cut(s) 143
PsuI RGATCY 1 cut(s) 89
SaqAI TTAA 2 cut(s) 6, 149
Sau3AI GATC 2 cut(s) 79, 89
SetI ASST 2 cut(s) 78, 103
SspMI CTAG 3 cut(s) 77, 93, 137
TaaI ACNGT 2 cut(s) 48, 154
TfiI GAWTC 1 cut(s) 143
Tru1I TTAA 2 cut(s) 6, 149
Tru9I TTAA 2 cut(s) 6, 149
TspDTI ATGAA 2 cut(s) 27, 32
XspI CTAG 3 cut(s) 77, 93, 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.