Rmu_ssc0000175.1_g000026

Lipolytic acyl hydrolase (LAH)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000175.1
OG0000265
Physical Location & Seq
Forward (+)
96828 .. 98782
1955 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000175.1_g000026.1.cds

Sequence Viewer

Length: 567 bp
atggaggccggaggcatcccagacctcttctgggtagaaatcaaggttggaggaggtcggggttgtaggtttctggccttccatggtttccggcgagcttgctgcacaccgctgagtttccgatcaccttcgccttcgccgcttgatcgaggctatctaggatgtccagagggaactggctcatcgaaagctgaactgaaatacaatgctcatgttgcctccaagtggggtgtgtggaattggttaacgagccgtggttccaccccattgatcaatgctttcagtcaagcaagtgccgatatggtcgatttgcatctttctgtggtgttcaaagcccttcactcggagaaaaactatcttcgaattcaggatcacacactaagtggtgaagtatcttcagtagatgtagcaacagagaagaatctggaccatcttctcaaagttggtgaaggactattgagacgaccagtttcaagggttaatttagagacaggcagattcgaagcttgtaatcatgagactaataaagaggctcttataaacatgtttgaaaaccctaattgctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Patatin

Protein Analysis

188

Amino Acids

20.75

Weight (kDa)

7.67

Isoelectric Point (pI)

38.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000265)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G26560
fragaria_vesca FvH4_2g34690 FvH4_2g34750 FvH4_2g34750 FvH4_2g34754 FvH4_2g34770 FvH4_2g34780 FvH4_2g34780 FvH4_2g34780 FvH4_2g34780 FvH4_2g34780 FvH4_2g34800 FvH4_2g34800 FvH4_2g34811 FvH4_4g24280 FvH4_4g24280
malus_domestica MD08G1104900.v1.1 MD08G1105100.v1.1 MD08G1105300.v1.1 MD08G1105500.v1.1 MD08G1105900.v1.1 MD15G1085500.v1.1 MD15G1085600.v1.1 MD15G1085800.v1.1 MD15G1085900.v1.1 MD15G1086000.v1.1 MD15G1086500.v1.1
prunus_persica Prupe.1G439600_v2.0.a1 Prupe.1G439700_v2.0.a1 Prupe.1G439800_v2.0.a1 Prupe.1G439800_v2.0.a1 Prupe.1G439900_v2.0.a1 Prupe.1G439900_v2.0.a1 Prupe.1G440100_v2.0.a1
pyrus_communis pycom08g08620 pycom08g08640 pycom08g08650 pycom08g08680 pycom08g08700 pycom15g08080 pycom15g08090 pycom15g08110 pycom15g08140
rosa_chinensis RchiOBHm_Chr3g0482851 RchiOBHm_Chr3g0482871 RchiOBHm_Chr6g0307241 RchiOBHm_Chr6g0307291 RchiOBHm_Chr6g0307341 RchiOBHm_Chr6g0307351 RchiOBHm_Chr6g0307381 RchiOBHm_Chr6g0307391 RchiOBHm_Chr6g0307491 RchiOBHm_Chr6g0307661
rosa_laevigata RLG00000008291 RLG00000010711 RLG00000010718 RLG00000010719 RLG00000010721 RLG00000010722 RLG00000023319 RLG00000023320
rosa_multiflora Rmu_co8005452.1_g000001 Rmu_co8126120.1_g000001 Rmu_sc0000031.1_g000008 Rmu_sc0000031.1_g000009 Rmu_sc0000031.1_g000011 Rmu_sc0000031.1_g000020 Rmu_sc0001612.1_g000003 Rmu_sc0003419.1_g000004 Rmu_sc0005715.1_g000002 Rmu_sc0005715.1_g000003 Rmu_sc0010071.1_g000001 Rmu_sc0010071.1_g000008 Rmu_ssc0000175.1_g000026 Rmu_ssc0000175.1_g000028
rosa_roxburghii Rroxscaffold_2G00138670 Rroxscaffold_6G00398870 Rroxscaffold_7G00160950 Rroxscaffold_7G00160980 Rroxscaffold_7G00161030 Rroxscaffold_7G00161040 Rroxscaffold_7G00161060
rosa_rugosa Rorug03G0201600 Rorug03G0201900 Rorug05G0124400 Rorug06G0357900 Rorug06G0358000 Rorug06G0358200 Rorug06G0358300 Rorug06G0358400 Rorug06G0358700 Rorug06G0358800
rosa_samantha Rh2AG174100 Rh2AG174200 Rh2AG174600 Rh2BG015200 Rh2CG179000 Rh2CG179100 Rh2CG179200 Rh2CG181300 Rh2DG180400 Rh3AG250400 Rh3AG250600 Rh3BG286800 Rh3CG284300 Rh3DG279900 Rh5DG283200 Rh5DG283300 Rh5DG283400 Rh6AG468500 Rh6AG468700 Rh6BG431300 Rh6BG431600 Rh6BG431700 Rh6BG431800 Rh6BG431900 Rh6BG479000 Rh6BG479300 Rh6CG483700 Rh6CG483800 Rh6CG484700 Rh6DG470300 Rh6DG470400 Rh6DG470600 Rh6DG471300 Rh6DG471500
rosa_wichuraiana Rw3G022650 Rw3G022670 Rw6G040840 Rw6G040850 Rw6G040920

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 539
AciI CCGC 2 cut(s) 110, 140
AclWI GGATC 1 cut(s) 378
AcsI RAATTY 1 cut(s) 363
AcuI CTGAAG 1 cut(s) 381
AdeI CACNNNGTG 1 cut(s) 383
AfiI CCNNNNNNNGG 3 cut(s) 31, 225, 343
AflIII ACRYGT 1 cut(s) 543
AgsI TTSAA 3 cut(s) 331, 474, 551
AjuI GAANNNNNNNTTGG 2 cut(s) 30, 62
AluBI AGCT 3 cut(s) 98, 191, 506
AluI AGCT 3 cut(s) 98, 191, 506
Alw26I GTCTC 3 cut(s) 454, 482, 512
AlwI GGATC 1 cut(s) 378
AoxI GGCC 2 cut(s) 6, 75
ApeKI GCWGC 1 cut(s) 102
ApoI RAATTY 1 cut(s) 363
AspS9I GGNCC 1 cut(s) 427
AsuHPI GGTGA 3 cut(s) 117, 398, 458
AsuII TTCGAA 2 cut(s) 361, 501
AvaII GGWCC 1 cut(s) 427
BbvI GCAGC 1 cut(s) 89
BccI CCATC 1 cut(s) 438
BceAI ACGGC 1 cut(s) 237
BcgI CGANNNNNNTGC 2 cut(s) 84, 118
BclI TGATCA 1 cut(s) 270
BcoDI GTCTC 3 cut(s) 454, 482, 512
BfaI CTAG 1 cut(s) 158
BisI GCNGC 2 cut(s) 103, 140
BlsI GCNGC 2 cut(s) 104, 141
Bme18I GGWCC 1 cut(s) 427
BmgT120I GGNCC 1 cut(s) 427
BmiI GGNNCC 1 cut(s) 259
BmsI GCATC 2 cut(s) 24, 322
Bpu14I TTCGAA 2 cut(s) 361, 501
BsaBI GATNNNNATC 1 cut(s) 312
BsaJI CCNNGG 2 cut(s) 82, 253
Bsc4I CCNNNNNNNGG 3 cut(s) 31, 225, 343
Bse1I ACTGG 2 cut(s) 181, 467
Bse8I GATNNNNATC 1 cut(s) 312
BseDI CCNNGG 2 cut(s) 82, 253
BseGI GGATG 2 cut(s) 15, 167
BseJI GATNNNNATC 1 cut(s) 312
BseLI CCNNNNNNNGG 3 cut(s) 31, 225, 343
BseMII CTCAG 1 cut(s) 104
BseNI ACTGG 2 cut(s) 181, 467
BseRI GAGGAG 1 cut(s) 66
BseXI GCAGC 1 cut(s) 89
BsgI GTGCAG 1 cut(s) 88
BshFI GGCC 2 cut(s) 8, 77
BsiSI CCGG 2 cut(s) 9, 91
BslI CCNNNNNNNGG 3 cut(s) 31, 225, 343
BsmAI GTCTC 3 cut(s) 454, 482, 512
BsmBI CGTCTC 1 cut(s) 454
BsnI GGCC 2 cut(s) 8, 77
Bsp119I TTCGAA 2 cut(s) 361, 501
Bsp143I GATC 4 cut(s) 122, 145, 270, 370
Bsp19I CCATGG 1 cut(s) 82
BspACI CCGC 2 cut(s) 110, 140
BspANI GGCC 2 cut(s) 8, 77
BspCNI CTCAG 1 cut(s) 105
BspHI TCATGA 1 cut(s) 514
BspLI GGNNCC 1 cut(s) 259
BspPI GGATC 1 cut(s) 378
BspT104I TTCGAA 2 cut(s) 361, 501
BsrI ACTGG 2 cut(s) 181, 467
BssECI CCNNGG 2 cut(s) 82, 253
BssMI GATC 4 cut(s) 122, 145, 270, 370
BssT1I CCWWGG 1 cut(s) 82
Bst6I CTCTTC 1 cut(s) 32
BstBI TTCGAA 2 cut(s) 361, 501
BstC8I GCNNGC 2 cut(s) 96, 100
BstDEI CTNAG 2 cut(s) 113, 380
BstDSI CCRYGG 2 cut(s) 82, 253
BstF5I GGATG 2 cut(s) 15, 167
BstKTI GATC 4 cut(s) 125, 148, 273, 373
BstMAI GTCTC 3 cut(s) 454, 482, 512
BstMBI GATC 4 cut(s) 122, 145, 270, 370
BstMWI GCNNNNNNNGC 2 cut(s) 139, 215
BstNSI RCATGY 1 cut(s) 547
BstV1I GCAGC 1 cut(s) 89
BsuRI GGCC 2 cut(s) 8, 77
BtgI CCRYGG 2 cut(s) 82, 253
BtsCI GGATG 2 cut(s) 15, 167
Cac8I GCNNGC 2 cut(s) 96, 100
CciI TCATGA 1 cut(s) 514
Cfr13I GGNCC 1 cut(s) 427
CviAII CATG 4 cut(s) 83, 212, 515, 544
DdeI CTNAG 2 cut(s) 113, 380
DpnI GATC 4 cut(s) 124, 147, 272, 372
DpnII GATC 4 cut(s) 122, 145, 270, 370
DraIII CACNNNGTG 1 cut(s) 383
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
Eco130I CCWWGG 1 cut(s) 82
Eco47I GGWCC 1 cut(s) 427
Eco57I CTGAAG 1 cut(s) 381
EcoRI GAATTC 1 cut(s) 363
EcoT14I CCWWGG 1 cut(s) 82
ErhI CCWWGG 1 cut(s) 82
Esp3I CGTCTC 1 cut(s) 454
FaeI CATG 4 cut(s) 86, 215, 518, 547
FaiI YATR 6 cut(s) 84, 213, 302, 516, 539, 545
FalI AAGNNNNNCTT 2 cut(s) 519, 551
FatI CATG 4 cut(s) 82, 211, 514, 543
FbaI TGATCA 1 cut(s) 270
Fnu4HI GCNGC 2 cut(s) 103, 140
FokI GGATG 2 cut(s) 2, 174
Fsp4HI GCNGC 2 cut(s) 103, 140
FspBI CTAG 1 cut(s) 158
GluI GCNGC 2 cut(s) 103, 140
HaeIII GGCC 2 cut(s) 8, 77
HapII CCGG 2 cut(s) 9, 91
Hin1II CATG 4 cut(s) 86, 215, 518, 547
HincII GTYRAC 1 cut(s) 246
HindII GTYRAC 1 cut(s) 246
HindIII AAGCTT 1 cut(s) 504
HinfI GANTC 2 cut(s) 421, 498
HpaI GTTAAC 1 cut(s) 246
HpaII CCGG 2 cut(s) 9, 91
HphI GGTGA 3 cut(s) 117, 398, 458
Hpy166II GTNNAC 1 cut(s) 246
Hpy188I TCNGA 2 cut(s) 122, 346
Hpy188III TCNNGA 4 cut(s) 167, 368, 425, 515
Hpy8I GTNNAC 1 cut(s) 246
HpyAV CCTTC 5 cut(s) 88, 138, 144, 347, 443
HpyCH4V TGCA 2 cut(s) 105, 313
HpyF10VI GCNNNNNNNGC 2 cut(s) 139, 215
HpyF3I CTNAG 2 cut(s) 113, 380
Hsp92II CATG 4 cut(s) 86, 215, 518, 547
Ksp22I TGATCA 1 cut(s) 270
KspAI GTTAAC 1 cut(s) 246
Kzo9I GATC 4 cut(s) 122, 145, 270, 370
Lsp1109I GCAGC 1 cut(s) 89
LweI GCATC 2 cut(s) 24, 322
MaeI CTAG 1 cut(s) 158
MalI GATC 4 cut(s) 124, 147, 272, 372
MboI GATC 4 cut(s) 122, 145, 270, 370
MboII GAAGA 5 cut(s) 19, 350, 387, 425, 430
MluCI AATT 4 cut(s) 238, 363, 481, 559
MmeI TCCRAC 1 cut(s) 28
MnlI CCTC 8 cut(s) 5, 35, 44, 47, 143, 163, 229, 523
MseI TTAA 2 cut(s) 245, 480
MspA1I CMGCKG 1 cut(s) 112
MspI CCGG 2 cut(s) 9, 91
MwoI GCNNNNNNNGC 2 cut(s) 139, 215
NcoI CCATGG 1 cut(s) 82
NdeII GATC 4 cut(s) 122, 145, 270, 370
NlaIII CATG 4 cut(s) 86, 215, 518, 547
NlaIV GGNNCC 1 cut(s) 259
NspI RCATGY 1 cut(s) 547
NspV TTCGAA 2 cut(s) 361, 501
PagI TCATGA 1 cut(s) 514
PciI ACATGT 1 cut(s) 543
PfeI GAWTC 2 cut(s) 421, 498
PkrI GCNGC 2 cut(s) 104, 141
PscI ACATGT 1 cut(s) 543
PsiI TTATAA 1 cut(s) 539
PspN4I GGNNCC 1 cut(s) 259
PspPI GGNCC 1 cut(s) 427
SaqAI TTAA 2 cut(s) 245, 480
SatI GCNGC 2 cut(s) 103, 140
Sau3AI GATC 4 cut(s) 122, 145, 270, 370
Sau96I GGNCC 1 cut(s) 427
SetI ASST 8 cut(s) 27, 48, 58, 71, 100, 130, 193, 508
SfaNI GCATC 2 cut(s) 24, 322
SfuI TTCGAA 2 cut(s) 361, 501
SinI GGWCC 1 cut(s) 427
Sse9I AATT 4 cut(s) 238, 363, 481, 559
SsiI CCGC 2 cut(s) 110, 140
SspMI CTAG 1 cut(s) 158
StyI CCWWGG 1 cut(s) 82
TaqI TCGA 5 cut(s) 148, 185, 306, 361, 501
TasI AATT 4 cut(s) 238, 363, 481, 559
TauI GCSGC 1 cut(s) 142
TfiI GAWTC 2 cut(s) 421, 498
Tru1I TTAA 2 cut(s) 245, 480
Tru9I TTAA 2 cut(s) 245, 480
TseI GCWGC 1 cut(s) 102
VpaK11BI GGWCC 1 cut(s) 427
XapI RAATTY 1 cut(s) 363
XceI RCATGY 1 cut(s) 547
XcmI CCANNNNNNNNNTGG 1 cut(s) 27
XspI CTAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.