Rroxscaffold_3G00225560

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0000783
Physical Location & Seq
Reverse (-)
8780151 .. 8781441
1291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00225560.1

Sequence Viewer

Length: 180 bp
ATGGCTTTGTCTCTCTCTCGAGAGTTTCCTCTCTTTGGCGAGCGGCGGCGACAAACCTTCTCGCTTGCTTCATATCTGCCCCTATCTTCGGTTAGGGGAGGATGTTCTGTTGATGTTGGTGGGATTGAGATTGGAATCATGATCGATCAGATCTGGTTTGGTGGTCCTGGGGCATGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.43

Weight (kDa)

6.04

Isoelectric Point (pI)

55.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 43
AciI CCGC 2 cut(s) 43, 46
AfiI CCNNNNNNNGG 2 cut(s) 35, 88
AjnI CCWGG 1 cut(s) 166
Alw26I GTCTC 1 cut(s) 15
Ama87I CYCGRG 1 cut(s) 18
AspS9I GGNCC 1 cut(s) 164
AvaI CYCGRG 1 cut(s) 18
AvaII GGWCC 1 cut(s) 164
BciT130I CCWGG 1 cut(s) 168
BcoDI GTCTC 1 cut(s) 15
BglII AGATCT 1 cut(s) 150
BisI GCNGC 2 cut(s) 44, 47
BlsI GCNGC 2 cut(s) 45, 48
Bme1390I CCNGG 1 cut(s) 168
Bme18I GGWCC 1 cut(s) 164
BmeT110I CYCGRG 1 cut(s) 18
BmgT120I GGNCC 1 cut(s) 164
BmrFI CCNGG 1 cut(s) 168
Bsa29I ATCGAT 1 cut(s) 144
BsaBI GATNNNNATC 1 cut(s) 134
BsaJI CCNNGG 1 cut(s) 167
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 88
Bse8I GATNNNNATC 1 cut(s) 134
BseBI CCWGG 1 cut(s) 168
BseCI ATCGAT 1 cut(s) 144
BseDI CCNNGG 1 cut(s) 167
BseGI GGATG 1 cut(s) 107
BseJI GATNNNNATC 1 cut(s) 134
BseLI CCNNNNNNNGG 2 cut(s) 35, 88
BshVI ATCGAT 1 cut(s) 144
BsiHKCI CYCGRG 1 cut(s) 18
BslI CCNNNNNNNGG 2 cut(s) 35, 88
BsmAI GTCTC 1 cut(s) 15
BsoBI CYCGRG 1 cut(s) 18
Bsp143I GATC 3 cut(s) 141, 145, 150
BspACI CCGC 2 cut(s) 43, 46
BspDI ATCGAT 1 cut(s) 144
BspHI TCATGA 1 cut(s) 138
BsrBI CCGCTC 1 cut(s) 43
BssECI CCNNGG 1 cut(s) 167
BssMI GATC 3 cut(s) 141, 145, 150
Bst2UI CCWGG 1 cut(s) 168
BstC8I GCNNGC 2 cut(s) 41, 66
BstF5I GGATG 1 cut(s) 107
BstKTI GATC 3 cut(s) 144, 148, 153
BstMAI GTCTC 1 cut(s) 15
BstMBI GATC 3 cut(s) 141, 145, 150
BstNI CCWGG 1 cut(s) 168
BstSCI CCNGG 1 cut(s) 166
BstX2I RGATCY 1 cut(s) 150
BstYI RGATCY 1 cut(s) 150
Bsu15I ATCGAT 1 cut(s) 144
BsuTUI ATCGAT 1 cut(s) 144
BtsCI GGATG 1 cut(s) 107
Cac8I GCNNGC 2 cut(s) 41, 66
CciI TCATGA 1 cut(s) 138
Cfr13I GGNCC 1 cut(s) 164
ClaI ATCGAT 1 cut(s) 144
CviAII CATG 2 cut(s) 139, 174
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DpnI GATC 3 cut(s) 143, 147, 152
DpnII GATC 3 cut(s) 141, 145, 150
Eco47I GGWCC 1 cut(s) 164
Eco88I CYCGRG 1 cut(s) 18
EcoRII CCWGG 1 cut(s) 166
FaeI CATG 2 cut(s) 142, 177
FaiI YATR 3 cut(s) 73, 140, 175
FatI CATG 2 cut(s) 138, 173
Fnu4HI GCNGC 2 cut(s) 44, 47
FokI GGATG 1 cut(s) 114
Fsp4HI GCNGC 2 cut(s) 44, 47
GluI GCNGC 2 cut(s) 44, 47
Hin1II CATG 2 cut(s) 142, 177
HinfI GANTC 1 cut(s) 135
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 3 cut(s) 18, 20, 139
HpyAV CCTTC 1 cut(s) 67
Hsp92II CATG 2 cut(s) 142, 177
Kzo9I GATC 3 cut(s) 141, 145, 150
LpnPI CCDG 2 cut(s) 139, 153
MalI GATC 3 cut(s) 143, 147, 152
MbiI CCGCTC 1 cut(s) 43
MboI GATC 3 cut(s) 141, 145, 150
MboII GAAGA 1 cut(s) 78
MflI RGATCY 1 cut(s) 150
MnlI CCTC 2 cut(s) 39, 92
MspR9I CCNGG 1 cut(s) 168
MvaI CCWGG 1 cut(s) 168
NdeII GATC 3 cut(s) 141, 145, 150
NlaIII CATG 2 cut(s) 142, 177
PaeR7I CTCGAG 1 cut(s) 18
PagI TCATGA 1 cut(s) 138
PfeI GAWTC 1 cut(s) 135
PkrI GCNGC 2 cut(s) 45, 48
Psp6I CCWGG 1 cut(s) 166
PspGI CCWGG 1 cut(s) 166
PspPI GGNCC 1 cut(s) 164
PsuI RGATCY 1 cut(s) 150
SatI GCNGC 2 cut(s) 44, 47
Sau3AI GATC 3 cut(s) 141, 145, 150
Sau96I GGNCC 1 cut(s) 164
ScrFI CCNGG 1 cut(s) 168
SetI ASST 1 cut(s) 59
Sfr274I CTCGAG 1 cut(s) 18
SgeI CNNG 7 cut(s) 30, 32, 52, 73, 77, 151, 166
SinI GGWCC 1 cut(s) 164
SlaI CTCGAG 1 cut(s) 18
SmlI CTYRAG 1 cut(s) 18
SmoI CTYRAG 1 cut(s) 18
SsiI CCGC 2 cut(s) 43, 46
StyD4I CCNGG 1 cut(s) 166
TaqI TCGA 2 cut(s) 19, 144
TauI GCSGC 2 cut(s) 46, 49
TfiI GAWTC 1 cut(s) 135
TspDTI ATGAA 1 cut(s) 60
VpaK11BI GGWCC 1 cut(s) 164
XhoI CTCGAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.