Rw5G018750

AP2-like ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
24191341 .. 24196005
4665 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G018750.1

Sequence Viewer

Length: 270 bp
ATGGATGGTATGGGAAACACTGTAGCACGATGGAATGCGAGAAGAGTCAATCTTTTCTGGCTTCTTTTGCAACTTCCAACCTATCCGTTGAGCAACTACGTAAATGACATGGAGGAGCTGACGTTGTTTACCAAGAAAGACTACCTGCTCCATATCCGAAGAAACATGACAAGCTTTCCCAGGACAATGTCCAAATATAGTGGAGTTTCAAGACTTATAATCATTAAATCAGATCTCTTCTTTGCAATTCCAACAGAACTCAATACGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.49

Weight (kDa)

9.77

Isoelectric Point (pI)

55.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 218
Acc36I ACCTGC 1 cut(s) 153
AgsI TTSAA 1 cut(s) 210
AjnI CCWGG 1 cut(s) 179
AluBI AGCT 2 cut(s) 118, 174
AluI AGCT 2 cut(s) 118, 174
BccI CCATC 1 cut(s) 24
BciT130I CCWGG 1 cut(s) 181
BfmI CTRYAG 1 cut(s) 21
BfuAI ACCTGC 1 cut(s) 153
BglII AGATCT 1 cut(s) 232
Bme1390I CCNGG 1 cut(s) 181
BmrFI CCNGG 1 cut(s) 181
BsaAI YACGTR 2 cut(s) 100, 267
BsaJI CCNNGG 1 cut(s) 179
BsaXI ACNNNNNCTCC 2 cut(s) 107, 137
BseBI CCWGG 1 cut(s) 181
BseDI CCNNGG 1 cut(s) 179
BseGI GGATG 1 cut(s) 10
BseRI GAGGAG 1 cut(s) 128
BsmI GAATGC 1 cut(s) 40
Bsp143I GATC 1 cut(s) 232
BspMI ACCTGC 1 cut(s) 153
BssECI CCNNGG 1 cut(s) 179
BssMI GATC 1 cut(s) 232
Bst2UI CCWGG 1 cut(s) 181
Bst4CI ACNGT 1 cut(s) 22
Bst6I CTCTTC 2 cut(s) 37, 242
BstBAI YACGTR 2 cut(s) 100, 267
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 235
BstMBI GATC 1 cut(s) 232
BstMWI GCNNNNNNNGC 1 cut(s) 67
BstNI CCWGG 1 cut(s) 181
BstSCI CCNGG 1 cut(s) 179
BstSFI CTRYAG 1 cut(s) 21
BstSNI TACGTA 2 cut(s) 100, 267
BstX2I RGATCY 1 cut(s) 232
BstYI RGATCY 1 cut(s) 232
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 1 cut(s) 18
BveI ACCTGC 1 cut(s) 153
CspCI CAANNNNNGTGG 2 cut(s) 181, 216
CviAII CATG 2 cut(s) 109, 166
CviJI RGCY 3 cut(s) 61, 118, 174
CviKI_1 RGCY 3 cut(s) 61, 118, 174
DpnI GATC 1 cut(s) 234
DpnII GATC 1 cut(s) 232
Eam1104I CTCTTC 2 cut(s) 37, 242
EarI CTCTTC 2 cut(s) 37, 242
Eco105I TACGTA 2 cut(s) 100, 267
EcoRII CCWGG 1 cut(s) 179
FaeI CATG 2 cut(s) 112, 169
FaiI YATR 6 cut(s) 11, 110, 153, 167, 198, 218
FatI CATG 2 cut(s) 108, 165
FokI GGATG 1 cut(s) 17
Hin1II CATG 2 cut(s) 112, 169
HindIII AAGCTT 1 cut(s) 172
HinfI GANTC 1 cut(s) 45
Hpy166II GTNNAC 1 cut(s) 129
Hpy188I TCNGA 2 cut(s) 158, 232
Hpy188III TCNNGA 1 cut(s) 210
Hpy8I GTNNAC 1 cut(s) 129
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4IV ACGT 3 cut(s) 99, 122, 266
HpyCH4V TGCA 2 cut(s) 70, 245
HpyF10VI GCNNNNNNNGC 1 cut(s) 67
HpySE526I ACGT 3 cut(s) 99, 122, 266
Hsp92II CATG 2 cut(s) 112, 169
Kzo9I GATC 1 cut(s) 232
LmnI GCTCC 2 cut(s) 115, 153
LpnPI CCDG 4 cut(s) 43, 158, 166, 193
MaeII ACGT 3 cut(s) 99, 122, 266
MalI GATC 1 cut(s) 234
MboI GATC 1 cut(s) 232
MboII GAAGA 3 cut(s) 54, 171, 229
MflI RGATCY 1 cut(s) 232
MluCI AATT 1 cut(s) 246
MlyI GAGTC 1 cut(s) 54
MmeI TCCRAC 1 cut(s) 101
MnlI CCTC 1 cut(s) 106
MseI TTAA 1 cut(s) 225
MspR9I CCNGG 1 cut(s) 181
Mva1269I GAATGC 1 cut(s) 40
MvaI CCWGG 1 cut(s) 181
MwoI GCNNNNNNNGC 1 cut(s) 67
NdeII GATC 1 cut(s) 232
NlaIII CATG 2 cut(s) 112, 169
PctI GAATGC 1 cut(s) 40
PflFI GACNNNGTC 1 cut(s) 187
PleI GAGTC 1 cut(s) 53
PpsI GAGTC 1 cut(s) 53
Ppu21I YACGTR 2 cut(s) 100, 267
PsiI TTATAA 1 cut(s) 218
Psp6I CCWGG 1 cut(s) 179
PspGI CCWGG 1 cut(s) 179
PsuI RGATCY 1 cut(s) 232
PsyI GACNNNGTC 1 cut(s) 187
SaqAI TTAA 1 cut(s) 225
Sau3AI GATC 1 cut(s) 232
SchI GAGTC 1 cut(s) 54
ScrFI CCNGG 1 cut(s) 181
SetI ASST 7 cut(s) 83, 102, 120, 125, 147, 176, 269
SfcI CTRYAG 1 cut(s) 21
SnaBI TACGTA 2 cut(s) 100, 267
Sse9I AATT 1 cut(s) 246
StyD4I CCNGG 1 cut(s) 179
TaaI ACNGT 1 cut(s) 22
TaiI ACGT 3 cut(s) 102, 125, 269
TasI AATT 1 cut(s) 246
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TscAI CASTG 1 cut(s) 25
TspGWI ACGGA 1 cut(s) 75
TspRI CASTG 1 cut(s) 25
Tth111I GACNNNGTC 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.