Rh7DG370000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0000783
Physical Location & Seq
Reverse (-)
50110472 .. 50111415
944 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG370000.1

Sequence Viewer

Length: 276 bp
ATGTGTCTGAATAGTGAATTTTGGTGGGCTGACGGCTTCGTCTTCTTCTCAAATTCCTCGTTGTATTCCAATGATGGTGGTGGTGCAGATCTCAGGGCAGGTCCAACTGGCTGTCTTTGGCTCATGTTGGCGCGGTATCTGGTCTTCAATGGAGGAGGCGGTAGTTTGCCTCGGGCTGGTCTCTGTTTGACGTGGTCTTCAGTTCCAATAGTGGCTATGGCGATGGCTGAGTGTGCGTTGGATGTTGCCAACAATGAAGGTGCAAGGTCGGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

9.63

Weight (kDa)

4.34

Isoelectric Point (pI)

39.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 38
Acc36I ACCTGC 1 cut(s) 89
AccII CGCG 1 cut(s) 133
AciI CCGC 2 cut(s) 133, 159
AcsI RAATTY 2 cut(s) 17, 52
AcuI CTGAAG 1 cut(s) 183
AfiI CCNNNNNNNGG 1 cut(s) 176
AgsI TTSAA 1 cut(s) 148
AjiI CACGTC 1 cut(s) 192
Alw26I GTCTC 1 cut(s) 185
Ama87I CYCGRG 1 cut(s) 171
ApoI RAATTY 2 cut(s) 17, 52
AspLEI GCGC 1 cut(s) 133
AspS9I GGNCC 1 cut(s) 101
AvaI CYCGRG 1 cut(s) 171
AvaII GGWCC 1 cut(s) 101
BarI GAAGNNNNNNTAC 2 cut(s) 128, 160
BbsI GAAGAC 3 cut(s) 34, 136, 189
BccI CCATC 2 cut(s) 68, 217
BceAI ACGGC 1 cut(s) 49
BcoDI GTCTC 1 cut(s) 185
BfuAI ACCTGC 1 cut(s) 89
BglII AGATCT 1 cut(s) 88
Bme18I GGWCC 1 cut(s) 101
BmeT110I CYCGRG 1 cut(s) 171
BmgBI CACGTC 1 cut(s) 192
BmgT120I GGNCC 1 cut(s) 101
BpiI GAAGAC 3 cut(s) 34, 136, 189
BsaI GGTCTC 1 cut(s) 185
BsaJI CCNNGG 1 cut(s) 170
Bsc4I CCNNNNNNNGG 1 cut(s) 176
Bse1I ACTGG 1 cut(s) 112
BseDI CCNNGG 1 cut(s) 170
BseGI GGATG 1 cut(s) 247
BseLI CCNNNNNNNGG 1 cut(s) 176
BseMII CTCAG 2 cut(s) 106, 219
BseNI ACTGG 1 cut(s) 112
BseRI GAGGAG 1 cut(s) 168
BsgI GTGCAG 1 cut(s) 105
Bsh1236I CGCG 1 cut(s) 133
BsiHKCI CYCGRG 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 176
BsmAI GTCTC 1 cut(s) 185
Bso31I GGTCTC 1 cut(s) 185
BsoBI CYCGRG 1 cut(s) 171
Bsp143I GATC 1 cut(s) 88
BspACI CCGC 2 cut(s) 133, 159
BspCNI CTCAG 2 cut(s) 105, 220
BspFNI CGCG 1 cut(s) 133
BspMI ACCTGC 1 cut(s) 89
BspTNI GGTCTC 1 cut(s) 185
BsrI ACTGG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 170
BssMI GATC 1 cut(s) 88
BstDEI CTNAG 2 cut(s) 92, 228
BstF5I GGATG 1 cut(s) 247
BstFNI CGCG 1 cut(s) 133
BstHHI GCGC 1 cut(s) 133
BstKTI GATC 1 cut(s) 91
BstMAI GTCTC 1 cut(s) 185
BstMBI GATC 1 cut(s) 88
BstMWI GCNNNNNNNGC 1 cut(s) 233
BstUI CGCG 1 cut(s) 133
BstV2I GAAGAC 3 cut(s) 34, 136, 189
BstX2I RGATCY 1 cut(s) 88
BstYI RGATCY 1 cut(s) 88
BtgZI GCGATG 1 cut(s) 236
BtrI CACGTC 1 cut(s) 192
BtsCI GGATG 1 cut(s) 247
BveI ACCTGC 1 cut(s) 89
CfoI GCGC 1 cut(s) 133
Cfr13I GGNCC 1 cut(s) 101
CspCI CAANNNNNGTGG 2 cut(s) 58, 93
CviAII CATG 1 cut(s) 124
CviJI RGCY 7 cut(s) 29, 36, 111, 121, 176, 215, 227
CviKI_1 RGCY 7 cut(s) 29, 36, 111, 121, 176, 215, 227
DdeI CTNAG 2 cut(s) 92, 228
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
DrdI GACNNNNNNGTC 1 cut(s) 38
DseDI GACNNNNNNGTC 1 cut(s) 38
Eco31I GGTCTC 1 cut(s) 185
Eco47I GGWCC 1 cut(s) 101
Eco57I CTGAAG 1 cut(s) 183
Eco88I CYCGRG 1 cut(s) 171
FaeI CATG 1 cut(s) 127
FaiI YATR 2 cut(s) 125, 218
FatI CATG 1 cut(s) 123
FokI GGATG 1 cut(s) 254
GlaI GCGC 1 cut(s) 132
HhaI GCGC 1 cut(s) 133
Hin1II CATG 1 cut(s) 127
Hin6I GCGC 1 cut(s) 131
HinP1I GCGC 1 cut(s) 131
Hpy188I TCNGA 2 cut(s) 9, 271
HpyAV CCTTC 1 cut(s) 251
HpyCH4IV ACGT 1 cut(s) 191
HpyCH4V TGCA 2 cut(s) 86, 263
HpyF10VI GCNNNNNNNGC 1 cut(s) 233
HpyF3I CTNAG 2 cut(s) 92, 228
HpySE526I ACGT 1 cut(s) 191
Hsp92II CATG 1 cut(s) 127
HspAI GCGC 1 cut(s) 131
Kzo9I GATC 1 cut(s) 88
LpnPI CCDG 5 cut(s) 79, 84, 93, 125, 162
MaeII ACGT 1 cut(s) 191
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MboII GAAGA 4 cut(s) 34, 37, 136, 189
MflI RGATCY 1 cut(s) 88
MluCI AATT 2 cut(s) 17, 52
MmeI TCCRAC 3 cut(s) 128, 219, 249
MnlI CCTC 4 cut(s) 67, 146, 149, 180
MvnI CGCG 1 cut(s) 133
MwoI GCNNNNNNNGC 1 cut(s) 233
NdeII GATC 1 cut(s) 88
NlaIII CATG 1 cut(s) 127
PflFI GACNNNGTC 1 cut(s) 193
PspPI GGNCC 1 cut(s) 101
PsuI RGATCY 1 cut(s) 88
PsyI GACNNNGTC 1 cut(s) 193
Sau3AI GATC 1 cut(s) 88
Sau96I GGNCC 1 cut(s) 101
SetI ASST 4 cut(s) 103, 194, 262, 269
SinI GGWCC 1 cut(s) 101
Sse9I AATT 2 cut(s) 17, 52
SsiI CCGC 2 cut(s) 133, 159
TaiI ACGT 1 cut(s) 194
TasI AATT 2 cut(s) 17, 52
TspDTI ATGAA 1 cut(s) 270
Tth111I GACNNNGTC 1 cut(s) 193
VpaK11BI GGWCC 1 cut(s) 101
XapI RAATTY 2 cut(s) 17, 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.