Rh5AG205800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0000783
Physical Location & Seq
Reverse (-)
24354170 .. 24356447
2278 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG205800.1

Sequence Viewer

Length: 240 bp
ATGAAAGAGAGGCGGAACTGGAAAGGATGGAAAAAGAGAACAAATCGTAGTCCAAGGAACTTATTCCTTTGTAGAAATGGATGTTATGGGCTGATCGAGTCTACGGAATTAAATTTTCCATTGAGCAACTACGTAAATGACATGGAGGAGCTGACGTTGTTTACCAAGAAAGACTACCTGCTCCATATCCGAAGTTTTCAGAAACATGACAAGCTTTGCCAGGACAATGTCCAAATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.62

Weight (kDa)

9.51

Isoelectric Point (pI)

55.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 186
AccI GTMKAC 1 cut(s) 101
AciI CCGC 1 cut(s) 13
AcsI RAATTY 1 cut(s) 112
AjnI CCWGG 1 cut(s) 219
AluBI AGCT 2 cut(s) 151, 214
AluI AGCT 2 cut(s) 151, 214
ApoI RAATTY 1 cut(s) 112
Asp700I GAANNNNTTC 1 cut(s) 62
BccI CCATC 1 cut(s) 21
BciT130I CCWGG 1 cut(s) 221
BfuAI ACCTGC 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 221
BmrFI CCNGG 1 cut(s) 221
BsaAI YACGTR 1 cut(s) 133
BsaJI CCNNGG 1 cut(s) 53
BsaXI ACNNNNNCTCC 2 cut(s) 140, 170
Bse1I ACTGG 1 cut(s) 23
BseBI CCWGG 1 cut(s) 221
BseDI CCNNGG 1 cut(s) 53
BseGI GGATG 2 cut(s) 32, 86
BseNI ACTGG 1 cut(s) 23
BseRI GAGGAG 1 cut(s) 161
Bsp143I GATC 1 cut(s) 93
BspACI CCGC 1 cut(s) 13
BspMI ACCTGC 1 cut(s) 186
BsrI ACTGG 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 1 cut(s) 93
BssT1I CCWWGG 1 cut(s) 53
Bst2UI CCWGG 1 cut(s) 221
BstBAI YACGTR 1 cut(s) 133
BstF5I GGATG 2 cut(s) 32, 86
BstKTI GATC 1 cut(s) 96
BstMBI GATC 1 cut(s) 93
BstNI CCWGG 1 cut(s) 221
BstSCI CCNGG 1 cut(s) 219
BstSNI TACGTA 1 cut(s) 133
BtsCI GGATG 2 cut(s) 32, 86
BveI ACCTGC 1 cut(s) 186
CviAII CATG 2 cut(s) 142, 206
CviJI RGCY 3 cut(s) 91, 151, 214
CviKI_1 RGCY 3 cut(s) 91, 151, 214
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
EciI GGCGGA 1 cut(s) 28
Eco105I TACGTA 1 cut(s) 133
Eco130I CCWWGG 1 cut(s) 53
EcoRII CCWGG 1 cut(s) 219
EcoT14I CCWWGG 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 53
FaeI CATG 2 cut(s) 145, 209
FaiI YATR 5 cut(s) 87, 143, 186, 207, 238
FatI CATG 2 cut(s) 141, 205
FblI GTMKAC 1 cut(s) 101
FokI GGATG 2 cut(s) 39, 93
Hin1II CATG 2 cut(s) 145, 209
HindIII AAGCTT 1 cut(s) 212
HinfI GANTC 1 cut(s) 98
Hpy166II GTNNAC 2 cut(s) 102, 162
Hpy188I TCNGA 2 cut(s) 191, 201
Hpy8I GTNNAC 2 cut(s) 102, 162
HpyCH4IV ACGT 2 cut(s) 132, 155
HpySE526I ACGT 2 cut(s) 132, 155
Hsp92II CATG 2 cut(s) 145, 209
Kzo9I GATC 1 cut(s) 93
LmnI GCTCC 2 cut(s) 148, 186
LpnPI CCDG 4 cut(s) 4, 191, 206, 233
MaeII ACGT 2 cut(s) 132, 155
MalI GATC 1 cut(s) 95
MboI GATC 1 cut(s) 93
MluCI AATT 2 cut(s) 107, 112
MlyI GAGTC 1 cut(s) 107
MnlI CCTC 2 cut(s) 3, 139
MroXI GAANNNNTTC 1 cut(s) 62
MseI TTAA 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 221
MvaI CCWGG 1 cut(s) 221
NdeII GATC 1 cut(s) 93
NlaIII CATG 2 cut(s) 145, 209
PdmI GAANNNNTTC 1 cut(s) 62
PflFI GACNNNGTC 1 cut(s) 227
PleI GAGTC 1 cut(s) 106
PpsI GAGTC 1 cut(s) 106
Ppu21I YACGTR 1 cut(s) 133
Psp6I CCWGG 1 cut(s) 219
PspGI CCWGG 1 cut(s) 219
PsyI GACNNNGTC 1 cut(s) 227
SaqAI TTAA 1 cut(s) 110
Sau3AI GATC 1 cut(s) 93
SchI GAGTC 1 cut(s) 107
ScrFI CCNGG 1 cut(s) 221
SetI ASST 5 cut(s) 135, 153, 158, 180, 216
SnaBI TACGTA 1 cut(s) 133
Sse9I AATT 2 cut(s) 107, 112
SsiI CCGC 1 cut(s) 13
StyD4I CCNGG 1 cut(s) 219
StyI CCWWGG 1 cut(s) 53
TaiI ACGT 2 cut(s) 135, 158
TaqI TCGA 1 cut(s) 96
TasI AATT 2 cut(s) 107, 112
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 119
Tth111I GACNNNGTC 1 cut(s) 227
XapI RAATTY 1 cut(s) 112
XmiI GTMKAC 1 cut(s) 101
XmnI GAANNNNTTC 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.