Rh2CG648200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0000783
Physical Location & Seq
Reverse (-)
81706201 .. 81706410
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG648200.1

Sequence Viewer

Length: 210 bp
ATGACTGCGGAGGATCTGATCTTCTATGGATGGGTTGGTACTTTGTCCGGAGGCGGCGAAGGCTTCTGGTTGAAATCTAACCCCCTTGAAAATAGGGTAGAAGGTGGAGGTGCAGCGATGCTACTAGCTGTACAGGGATGCCGGCGAAGGTTCTGGGGTGGAAGATCGGAGATCTATGGTGACGGAGGTCAACGGCGGCTTACGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.52

Weight (kDa)

7.94

Isoelectric Point (pI)

56.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 47
AciI CCGC 3 cut(s) 8, 54, 196
AclWI GGATC 1 cut(s) 21
AfaI GTAC 2 cut(s) 40, 132
AgsI TTSAA 2 cut(s) 73, 89
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
AlwI GGATC 1 cut(s) 21
Aor13HI TCCGGA 1 cut(s) 47
ApeKI GCWGC 1 cut(s) 113
AsuHPI GGTGA 1 cut(s) 191
BbvI GCAGC 1 cut(s) 125
BccI CCATC 1 cut(s) 24
BfaI CTAG 1 cut(s) 125
BglII AGATCT 1 cut(s) 171
BisI GCNGC 3 cut(s) 55, 114, 197
BlsI GCNGC 3 cut(s) 56, 115, 198
BmsI GCATC 2 cut(s) 108, 128
BoxI GACNNNNGTC 1 cut(s) 186
BsaWI WCCGGW 1 cut(s) 47
Bse118I RCCGGY 1 cut(s) 141
BseAI TCCGGA 1 cut(s) 47
BseGI GGATG 2 cut(s) 35, 143
BseXI GCAGC 1 cut(s) 125
BsgI GTGCAG 1 cut(s) 132
BsiSI CCGG 2 cut(s) 48, 142
Bsp13I TCCGGA 1 cut(s) 47
Bsp1407I TGTACA 1 cut(s) 130
Bsp143I GATC 5 cut(s) 13, 18, 164, 171, 204
BspACI CCGC 3 cut(s) 8, 54, 196
BspEI TCCGGA 1 cut(s) 47
BspPI GGATC 1 cut(s) 21
BsrFI RCCGGY 1 cut(s) 141
BsrGI TGTACA 1 cut(s) 130
BssAI RCCGGY 1 cut(s) 141
BssMI GATC 5 cut(s) 13, 18, 164, 171, 204
BstAUI TGTACA 1 cut(s) 130
BstC8I GCNNGC 1 cut(s) 143
BstF5I GGATG 2 cut(s) 35, 143
BstKTI GATC 5 cut(s) 16, 21, 167, 174, 207
BstMBI GATC 5 cut(s) 13, 18, 164, 171, 204
BstMWI GCNNNNNNNGC 1 cut(s) 60
BstPAI GACNNNNGTC 1 cut(s) 186
BstV1I GCAGC 1 cut(s) 125
BstX2I RGATCY 2 cut(s) 13, 171
BstYI RGATCY 2 cut(s) 13, 171
BtgZI GCGATG 1 cut(s) 131
BtsCI GGATG 2 cut(s) 35, 143
Cac8I GCNNGC 1 cut(s) 143
Cfr10I RCCGGY 1 cut(s) 141
Csp6I GTAC 2 cut(s) 39, 131
CviJI RGCY 3 cut(s) 63, 128, 199
CviKI_1 RGCY 3 cut(s) 63, 128, 199
CviQI GTAC 2 cut(s) 39, 131
DpnI GATC 5 cut(s) 15, 20, 166, 173, 206
DpnII GATC 5 cut(s) 13, 18, 164, 171, 204
FaiI YATR 2 cut(s) 27, 177
Fnu4HI GCNGC 3 cut(s) 55, 114, 197
FokI GGATG 2 cut(s) 42, 150
Fsp4HI GCNGC 3 cut(s) 55, 114, 197
FspBI CTAG 1 cut(s) 125
GluI GCNGC 3 cut(s) 55, 114, 197
HapII CCGG 2 cut(s) 48, 142
HincII GTYRAC 1 cut(s) 191
HindII GTYRAC 1 cut(s) 191
HpaII CCGG 2 cut(s) 48, 142
HphI GGTGA 1 cut(s) 191
Hpy166II GTNNAC 1 cut(s) 191
Hpy188I TCNGA 3 cut(s) 18, 169, 209
Hpy188III TCNNGA 1 cut(s) 48
Hpy8I GTNNAC 1 cut(s) 191
HpyAV CCTTC 3 cut(s) 53, 95, 141
HpyCH4V TGCA 1 cut(s) 113
HpyF10VI GCNNNNNNNGC 1 cut(s) 60
Kpn2I TCCGGA 1 cut(s) 47
KroI GCCGGC 1 cut(s) 141
KroNI GCCGGC 1 cut(s) 143
Kzo9I GATC 5 cut(s) 13, 18, 164, 171, 204
LpnPI CCDG 5 cut(s) 52, 61, 119, 139, 155
Lsp1109I GCAGC 1 cut(s) 125
LweI GCATC 2 cut(s) 108, 128
MaeI CTAG 1 cut(s) 125
MaeIII GTNAC 1 cut(s) 179
MalI GATC 5 cut(s) 15, 20, 166, 173, 206
MboI GATC 5 cut(s) 13, 18, 164, 171, 204
MboII GAAGA 2 cut(s) 13, 174
MflI RGATCY 2 cut(s) 13, 171
MnlI CCTC 4 cut(s) 4, 44, 101, 179
MroI TCCGGA 1 cut(s) 47
MroNI GCCGGC 1 cut(s) 141
MspI CCGG 2 cut(s) 48, 142
MwoI GCNNNNNNNGC 1 cut(s) 60
NaeI GCCGGC 1 cut(s) 143
NdeII GATC 5 cut(s) 13, 18, 164, 171, 204
NgoMIV GCCGGC 1 cut(s) 141
NmuCI GTSAC 1 cut(s) 179
PdiI GCCGGC 1 cut(s) 143
PkrI GCNGC 3 cut(s) 56, 115, 198
PshAI GACNNNNGTC 1 cut(s) 186
PsuI RGATCY 2 cut(s) 13, 171
RsaI GTAC 2 cut(s) 40, 132
RsaNI GTAC 2 cut(s) 39, 131
SatI GCNGC 3 cut(s) 55, 114, 197
Sau3AI GATC 5 cut(s) 13, 18, 164, 171, 204
SetI ASST 5 cut(s) 106, 112, 130, 152, 190
SfaNI GCATC 2 cut(s) 108, 128
SgeI CNNG 7 cut(s) 60, 79, 98, 137, 146, 154, 166
SsiI CCGC 3 cut(s) 8, 54, 196
SspMI CTAG 1 cut(s) 125
TatI WGTACW 1 cut(s) 130
TauI GCSGC 2 cut(s) 57, 199
TseFI GTSAC 1 cut(s) 179
TseI GCWGC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 179
TspGWI ACGGA 1 cut(s) 198
XspI CTAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.