MD16G1237300.v1.1

Belongs to the terpene cyclase mutase family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Forward (+)
25009715 .. 25010348
634 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1237300.v1.1.491

Sequence Viewer

Length: 132 bp
ATGTTAGCTCTTATTGAAGCTGATCAGGAAATTATGGGAGTGCTTAACAAGAACTATATGATCAGTTCTGCTGCCTACAGAAATATCTCACCCATATGGACACTTGGAGCATATCGCAGGAATGCCCTTTAG

Protein Analysis

44

Amino Acids

4.87

Weight (kDa)

8.19

Isoelectric Point (pI)

73.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000689)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08040
malus_domestica MD09G1245800.v1.1 MD11G1098500.v1.1 MD16G1237300.v1.1
pyrus_communis pycom03g07090 pycom03g07100 pycom09g08560 pycom13g20460 pycom16g19890
rosa_chinensis RchiOBHm_Chr2g0118961 RchiOBHm_Chr2g0148671 RchiOBHm_Chr2g0150531 RchiOBHm_Chr2g0171301 RchiOBHm_Chr3g0455021 RchiOBHm_Chr6g0249451
rosa_laevigata RLG00000001225 RLG00000001972 RLG00000008936 RLG00000009011 RLG00000009032 RLG00000015372 RLG00000019992 RLG00000020680 RLG00000026543
rosa_multiflora Rmu_co8272705.1_g000001 Rmu_co8286409.1_g000001 Rmu_sc0000048.1_g000034 Rmu_sc0000824.1_g000002 Rmu_sc0001839.1_g000023 Rmu_sc0002070.1_g000050 Rmu_sc0002349.1_g000005 Rmu_sc0002453.1_g000019 Rmu_sc0006431.1_g000026 Rmu_sc0006758.1_g000001 Rmu_sc0006758.1_g000013 Rmu_sc0006997.1_g000015 Rmu_sc0008411.1_g000007 Rmu_sc0008411.1_g000019 Rmu_sc0008411.1_g000028 Rmu_sc0008678.1_g000001
rosa_roxburghii Rroxscaffold_3G00225850 Rroxscaffold_3G00225860 Rroxscaffold_3G00233460 Rroxscaffold_3G00234260 Rroxscaffold_3G00236880 Rroxscaffold_3G00236890 Rroxscaffold_4G00294300 Rroxscaffold_4G00297380 Rroxscaffold_4G00324650 Rroxscaffold_5G00352840 Rroxscaffold_5G00354640 Rroxscaffold_5G00361500 Rroxscaffold_7G00156410 Rroxscaffold_7G00156420 Rroxscaffold_7G00198110 Rroxscaffold_7G00198120
rosa_samantha Rh1CG014400 Rh1DG009900 Rh2AG465900 Rh2BG342900 Rh2CG452400 Rh2DG488000 Rh3DG303300 Rh4AG118000 Rh4DG159500 Rh5AG246100 Rh6AG232100 Rh6BG178700 Rh6DG174100 Rh7BG231200 Rh7DG380300
rosa_wichuraiana Rw2G027640 Rw2G038070 Rw6G005920 Rw7G034430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 17
AluBI AGCT 2 cut(s) 8, 20
AluI AGCT 2 cut(s) 8, 20
ApeKI GCWGC 1 cut(s) 71
AsuHPI GGTGA 1 cut(s) 81
BbvI GCAGC 1 cut(s) 58
BclI TGATCA 2 cut(s) 22, 60
BfmI CTRYAG 1 cut(s) 76
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
BseXI GCAGC 1 cut(s) 58
BsmI GAATGC 1 cut(s) 127
Bsp143I GATC 2 cut(s) 22, 60
BssMI GATC 2 cut(s) 22, 60
BstKTI GATC 2 cut(s) 25, 63
BstMBI GATC 2 cut(s) 22, 60
BstSFI CTRYAG 1 cut(s) 76
BstV1I GCAGC 1 cut(s) 58
CviJI RGCY 2 cut(s) 8, 20
CviKI_1 RGCY 2 cut(s) 8, 20
DpnI GATC 2 cut(s) 24, 62
DpnII GATC 2 cut(s) 22, 60
FaiI YATR 6 cut(s) 35, 57, 59, 95, 97, 112
FauNDI CATATG 1 cut(s) 95
FbaI TGATCA 2 cut(s) 22, 60
Fnu4HI GCNGC 1 cut(s) 72
Fsp4HI GCNGC 1 cut(s) 72
FspEI CC 9 cut(s) 11, 20, 21, 82, 88, 90, 103, 105, 106
GluI GCNGC 1 cut(s) 72
HphI GGTGA 1 cut(s) 81
Hpy188III TCNNGA 1 cut(s) 26
Ksp22I TGATCA 2 cut(s) 22, 60
Kzo9I GATC 2 cut(s) 22, 60
LmnI GCTCC 1 cut(s) 107
LpnPI CCDG 2 cut(s) 11, 103
Lsp1109I GCAGC 1 cut(s) 58
MalI GATC 2 cut(s) 24, 62
MboI GATC 2 cut(s) 22, 60
MluCI AATT 1 cut(s) 30
MseI TTAA 1 cut(s) 45
MslI CAYNNNNRTG 1 cut(s) 94
Mva1269I GAATGC 1 cut(s) 127
NdeI CATATG 1 cut(s) 95
NdeII GATC 2 cut(s) 22, 60
PctI GAATGC 1 cut(s) 127
PkrI GCNGC 1 cut(s) 73
RseI CAYNNNNRTG 1 cut(s) 94
SaqAI TTAA 1 cut(s) 45
SatI GCNGC 1 cut(s) 72
Sau3AI GATC 2 cut(s) 22, 60
SetI ASST 2 cut(s) 10, 22
SfcI CTRYAG 1 cut(s) 76
SgeI CNNG 3 cut(s) 38, 61, 116
SmiMI CAYNNNNRTG 1 cut(s) 94
Sse9I AATT 1 cut(s) 30
TasI AATT 1 cut(s) 30
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TseI GCWGC 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.