Rmu_sc0006431.1_g000026

Belongs to the terpene cyclase mutase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006431.1
OG0000689
Physical Location & Seq
Reverse (-)
91704 .. 97447
5744 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006431.1_g000026.1.cds

Sequence Viewer

Length: 478 bp
gtatggttcttggggagtctgcttcacctatgctggctggtttggcataaagggtttggttgctgctggaaggacttatgaagactgctctcgcatccgtaaagcatgtgattttttgttatccaaagagcttgcttctggtggatggggagaaagttatctatcatgtcagaacaaggtgtattcaaatcttcaggataataggccacatatagtcaatactgcatgggctatgttggccctgcttggtgctgggcaggcaaagagagacccaactccattgcaccgtgcagctaggaaagtcactaaccttgctgtgagctttaaaccaggactctcggtcgaattgaggattatcaagattcacagggtcgccatgaaagaaatcgggaaccaccacgaaaaatccagctgcagcaactttatccgcaagtttccttttccaaaagacaatgtgaagttcattttcatgcaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00100 ko01100 ko01110 map00100 map01100 map01110
Pfam Domains
Protein Families
SQHop_cyclase_C SQHop_cyclase_N

Protein Analysis

158

Amino Acids

17.75

Weight (kDa)

9.77

Isoelectric Point (pI)

28.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000689)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08040
malus_domestica MD09G1245800.v1.1 MD11G1098500.v1.1 MD16G1237300.v1.1
pyrus_communis pycom03g07090 pycom03g07100 pycom09g08560 pycom13g20460 pycom16g19890
rosa_chinensis RchiOBHm_Chr2g0118961 RchiOBHm_Chr2g0148671 RchiOBHm_Chr2g0150531 RchiOBHm_Chr2g0171301 RchiOBHm_Chr3g0455021 RchiOBHm_Chr6g0249451
rosa_laevigata RLG00000001225 RLG00000001972 RLG00000008936 RLG00000009011 RLG00000009032 RLG00000015372 RLG00000019992 RLG00000020680 RLG00000026543
rosa_multiflora Rmu_co8272705.1_g000001 Rmu_co8286409.1_g000001 Rmu_sc0000048.1_g000034 Rmu_sc0000824.1_g000002 Rmu_sc0001839.1_g000023 Rmu_sc0002070.1_g000050 Rmu_sc0002349.1_g000005 Rmu_sc0002453.1_g000019 Rmu_sc0006431.1_g000026 Rmu_sc0006758.1_g000001 Rmu_sc0006758.1_g000013 Rmu_sc0006997.1_g000015 Rmu_sc0008411.1_g000007 Rmu_sc0008411.1_g000019 Rmu_sc0008411.1_g000028 Rmu_sc0008678.1_g000001
rosa_roxburghii Rroxscaffold_3G00225850 Rroxscaffold_3G00225860 Rroxscaffold_3G00233460 Rroxscaffold_3G00234260 Rroxscaffold_3G00236880 Rroxscaffold_3G00236890 Rroxscaffold_4G00294300 Rroxscaffold_4G00297380 Rroxscaffold_4G00324650 Rroxscaffold_5G00352840 Rroxscaffold_5G00354640 Rroxscaffold_5G00361500 Rroxscaffold_7G00156410 Rroxscaffold_7G00156420 Rroxscaffold_7G00198110 Rroxscaffold_7G00198120
rosa_samantha Rh1CG014400 Rh1DG009900 Rh2AG465900 Rh2BG342900 Rh2CG452400 Rh2DG488000 Rh3DG303300 Rh4AG118000 Rh4DG159500 Rh5AG246100 Rh6AG232100 Rh6BG178700 Rh6DG174100 Rh7BG231200 Rh7DG380300
rosa_wichuraiana Rw2G027640 Rw2G038070 Rw6G005920 Rw7G034430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 428
AcuI CTGAAG 1 cut(s) 177
AgsI TTSAA 1 cut(s) 187
AhdI GACNNNNNGTC 1 cut(s) 339
AjnI CCWGG 1 cut(s) 329
AluBI AGCT 4 cut(s) 131, 294, 322, 412
AluI AGCT 4 cut(s) 131, 294, 322, 412
Alw26I GTCTC 1 cut(s) 262
AoxI GGCC 2 cut(s) 204, 238
ApeKI GCWGC 4 cut(s) 63, 291, 412, 415
AspS9I GGNCC 1 cut(s) 239
AsuHPI GGTGA 1 cut(s) 17
BbsI GAAGAC 1 cut(s) 88
BbvI GCAGC 4 cut(s) 50, 303, 399, 427
BccI CCATC 1 cut(s) 139
BciT130I CCWGG 1 cut(s) 331
BcoDI GTCTC 1 cut(s) 262
BfaI CTAG 1 cut(s) 295
BfmI CTRYAG 1 cut(s) 413
BisI GCNGC 4 cut(s) 64, 292, 413, 416
BlsI GCNGC 4 cut(s) 65, 293, 414, 417
Bme1390I CCNGG 1 cut(s) 331
BmeRI GACNNNNNGTC 1 cut(s) 339
BmgT120I GGNCC 1 cut(s) 239
BmiI GGNNCC 1 cut(s) 393
BmrFI CCNGG 1 cut(s) 331
BmsI GCATC 1 cut(s) 103
BpiI GAAGAC 1 cut(s) 88
BsaI GGTCTC 1 cut(s) 262
Bse3DI GCAATG 1 cut(s) 279
BseBI CCWGG 1 cut(s) 331
BseGI GGATG 2 cut(s) 94, 150
BseMI GCAATG 1 cut(s) 279
BseXI GCAGC 4 cut(s) 50, 303, 399, 427
BseYI CCCAGC 1 cut(s) 252
BsgI GTGCAG 1 cut(s) 310
Bsh1285I CGRYCG 1 cut(s) 343
BshFI GGCC 2 cut(s) 206, 240
BsiEI CGRYCG 1 cut(s) 343
BsmAI GTCTC 1 cut(s) 262
BsnI GGCC 2 cut(s) 206, 240
Bso31I GGTCTC 1 cut(s) 262
BspACI CCGC 1 cut(s) 428
BspANI GGCC 2 cut(s) 206, 240
BspLI GGNNCC 1 cut(s) 393
BspMAI CTGCAG 1 cut(s) 417
BspTNI GGTCTC 1 cut(s) 262
BsrDI GCAATG 1 cut(s) 279
Bst2UI CCWGG 1 cut(s) 331
Bst4CI ACNGT 1 cut(s) 288
BstC8I GCNNGC 3 cut(s) 35, 133, 259
BstF5I GGATG 2 cut(s) 94, 150
BstMAI GTCTC 1 cut(s) 262
BstMCI CGRYCG 1 cut(s) 343
BstMWI GCNNNNNNNGC 3 cut(s) 43, 237, 258
BstNI CCWGG 1 cut(s) 331
BstNSI RCATGY 1 cut(s) 109
BstSCI CCNGG 1 cut(s) 329
BstSFI CTRYAG 1 cut(s) 413
BstV1I GCAGC 4 cut(s) 50, 303, 399, 427
BstV2I GAAGAC 1 cut(s) 88
BsuRI GGCC 2 cut(s) 206, 240
BtsCI GGATG 2 cut(s) 94, 150
Cac8I GCNNGC 3 cut(s) 35, 133, 259
Cfr13I GGNCC 1 cut(s) 239
CviAII CATG 5 cut(s) 106, 166, 226, 377, 470
CviJI RGCY 8 cut(s) 37, 131, 206, 231, 240, 294, 322, 412
CviKI_1 RGCY 8 cut(s) 37, 131, 206, 231, 240, 294, 322, 412
DraI TTTAAA 1 cut(s) 326
DriI GACNNNNNGTC 1 cut(s) 339
Eam1105I GACNNNNNGTC 1 cut(s) 339
Eco31I GGTCTC 1 cut(s) 262
Eco57I CTGAAG 1 cut(s) 177
EcoRII CCWGG 1 cut(s) 329
FaeI CATG 5 cut(s) 109, 169, 229, 380, 473
FatI CATG 5 cut(s) 105, 165, 225, 376, 469
Fnu4HI GCNGC 4 cut(s) 64, 292, 413, 416
FokI GGATG 2 cut(s) 81, 157
Fsp4HI GCNGC 4 cut(s) 64, 292, 413, 416
FspBI CTAG 1 cut(s) 295
GluI GCNGC 4 cut(s) 64, 292, 413, 416
GsaI CCCAGC 1 cut(s) 256
HaeIII GGCC 2 cut(s) 206, 240
Hin1II CATG 5 cut(s) 109, 169, 229, 380, 473
HinfI GANTC 3 cut(s) 16, 334, 362
HphI GGTGA 1 cut(s) 17
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 3 cut(s) 195, 359, 389
HpyAV CCTTC 1 cut(s) 64
HpyCH4III ACNGT 1 cut(s) 288
HpyCH4V TGCA 5 cut(s) 225, 284, 291, 415, 473
HpyF10VI GCNNNNNNNGC 3 cut(s) 43, 237, 258
Hsp92II CATG 5 cut(s) 109, 169, 229, 380, 473
Lsp1109I GCAGC 4 cut(s) 50, 303, 399, 427
LweI GCATC 1 cut(s) 103
MaeI CTAG 1 cut(s) 295
MaeIII GTNAC 1 cut(s) 302
MboII GAAGA 2 cut(s) 93, 183
MluCI AATT 1 cut(s) 345
MlyI GAGTC 2 cut(s) 25, 328
MnlI CCTC 1 cut(s) 343
MseI TTAA 1 cut(s) 325
MslI CAYNNNNRTG 1 cut(s) 468
MspA1I CMGCKG 1 cut(s) 412
MspR9I CCNGG 1 cut(s) 331
MvaI CCWGG 1 cut(s) 331
MwoI GCNNNNNNNGC 3 cut(s) 43, 237, 258
NlaIII CATG 5 cut(s) 109, 169, 229, 380, 473
NlaIV GGNNCC 1 cut(s) 393
NmuCI GTSAC 1 cut(s) 302
NspI RCATGY 1 cut(s) 109
PfeI GAWTC 1 cut(s) 362
PkrI GCNGC 4 cut(s) 65, 293, 414, 417
PleI GAGTC 2 cut(s) 24, 328
PpsI GAGTC 2 cut(s) 24, 328
Psp6I CCWGG 1 cut(s) 329
PspFI CCCAGC 1 cut(s) 252
PspGI CCWGG 1 cut(s) 329
PspN4I GGNNCC 1 cut(s) 393
PspPI GGNCC 1 cut(s) 239
PstI CTGCAG 1 cut(s) 417
PvuII CAGCTG 1 cut(s) 412
RseI CAYNNNNRTG 1 cut(s) 468
SaqAI TTAA 1 cut(s) 325
SatI GCNGC 4 cut(s) 64, 292, 413, 416
Sau96I GGNCC 1 cut(s) 239
SchI GAGTC 2 cut(s) 25, 328
ScrFI CCNGG 1 cut(s) 331
SetI ASST 7 cut(s) 30, 133, 181, 296, 313, 324, 414
SfaNI GCATC 1 cut(s) 103
SfcI CTRYAG 1 cut(s) 413
SmiMI CAYNNNNRTG 1 cut(s) 468
Sse9I AATT 1 cut(s) 345
SsiI CCGC 1 cut(s) 428
SspMI CTAG 1 cut(s) 295
StyD4I CCNGG 1 cut(s) 329
TaaI ACNGT 1 cut(s) 288
TaqI TCGA 1 cut(s) 343
TaqII GACCGA 1 cut(s) 329
TasI AATT 1 cut(s) 345
TfiI GAWTC 1 cut(s) 362
Tru1I TTAA 1 cut(s) 325
Tru9I TTAA 1 cut(s) 325
TseFI GTSAC 1 cut(s) 302
TseI GCWGC 4 cut(s) 63, 291, 412, 415
Tsp45I GTSAC 1 cut(s) 302
TspDTI ATGAA 4 cut(s) 94, 393, 452, 458
TspGWI ACGGA 1 cut(s) 87
XceI RCATGY 1 cut(s) 109
XspI CTAG 1 cut(s) 295
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.