Rmu_co8272705.1_g000001

Belongs to the terpene cyclase mutase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8272705.1
OG0000689
Physical Location & Seq
Forward (+)
50 .. 659
610 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8272705.1_g000001.1.cds

Sequence Viewer

Length: 423 bp
atgcttgcctgttgggttgaagatccaaatggggactatttcaagaagcatctggcaagggtcccggattatttatgggttgctgaagatggaatgaagatgcaaagttttggcagtcaggagtgggatactggttttgccattcaagctttgcttgctactaatctaatggacgaaattggaccaacgctcgctagaggacatgacttcataaagaaatctcaggtcaaagacaacccatctggtgacttcaaaagcatgcaccgccacatttccaaaggatcgtggactttctccgatcaagatcatggatggcaagtttctgattgcactgcagaaggtttaaaggttagtaactttgctcaaatgcttcacgtcagtttttcttatccacctgttattactccatgtttctcaccatag

Protein Analysis

140

Amino Acids

15.79

Weight (kDa)

5.57

Isoelectric Point (pI)

35.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000689)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08040
malus_domestica MD09G1245800.v1.1 MD11G1098500.v1.1 MD16G1237300.v1.1
pyrus_communis pycom03g07090 pycom03g07100 pycom09g08560 pycom13g20460 pycom16g19890
rosa_chinensis RchiOBHm_Chr2g0118961 RchiOBHm_Chr2g0148671 RchiOBHm_Chr2g0150531 RchiOBHm_Chr2g0171301 RchiOBHm_Chr3g0455021 RchiOBHm_Chr6g0249451
rosa_laevigata RLG00000001225 RLG00000001972 RLG00000008936 RLG00000009011 RLG00000009032 RLG00000015372 RLG00000019992 RLG00000020680 RLG00000026543
rosa_multiflora Rmu_co8272705.1_g000001 Rmu_co8286409.1_g000001 Rmu_sc0000048.1_g000034 Rmu_sc0000824.1_g000002 Rmu_sc0001839.1_g000023 Rmu_sc0002070.1_g000050 Rmu_sc0002349.1_g000005 Rmu_sc0002453.1_g000019 Rmu_sc0006431.1_g000026 Rmu_sc0006758.1_g000001 Rmu_sc0006758.1_g000013 Rmu_sc0006997.1_g000015 Rmu_sc0008411.1_g000007 Rmu_sc0008411.1_g000019 Rmu_sc0008411.1_g000028 Rmu_sc0008678.1_g000001
rosa_roxburghii Rroxscaffold_3G00225850 Rroxscaffold_3G00225860 Rroxscaffold_3G00233460 Rroxscaffold_3G00234260 Rroxscaffold_3G00236880 Rroxscaffold_3G00236890 Rroxscaffold_4G00294300 Rroxscaffold_4G00297380 Rroxscaffold_4G00324650 Rroxscaffold_5G00352840 Rroxscaffold_5G00354640 Rroxscaffold_5G00361500 Rroxscaffold_7G00156410 Rroxscaffold_7G00156420 Rroxscaffold_7G00198110 Rroxscaffold_7G00198120
rosa_samantha Rh1CG014400 Rh1DG009900 Rh2AG465900 Rh2BG342900 Rh2CG452400 Rh2DG488000 Rh3DG303300 Rh4AG118000 Rh4DG159500 Rh5AG246100 Rh6AG232100 Rh6BG178700 Rh6DG174100 Rh7BG231200 Rh7DG380300
rosa_wichuraiana Rw2G027640 Rw2G038070 Rw6G005920 Rw7G034430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 265
AclWI GGATC 2 cut(s) 17, 289
AcuI CTGAAG 1 cut(s) 105
AgsI TTSAA 4 cut(s) 20, 43, 146, 253
AjiI CACGTC 1 cut(s) 376
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
AlwI GGATC 2 cut(s) 17, 289
AspS9I GGNCC 2 cut(s) 61, 182
AsuC2I CCSGG 1 cut(s) 65
AsuHPI GGTGA 2 cut(s) 257, 408
AvaII GGWCC 2 cut(s) 61, 182
BccI CCATC 3 cut(s) 83, 247, 306
BciVI GTATCC 1 cut(s) 121
BcnI CCSGG 1 cut(s) 65
BfaI CTAG 1 cut(s) 195
BfmI CTRYAG 1 cut(s) 333
BfuI GTATCC 1 cut(s) 121
Bme1390I CCNGG 1 cut(s) 65
Bme18I GGWCC 2 cut(s) 61, 182
BmgBI CACGTC 1 cut(s) 376
BmgT120I GGNCC 2 cut(s) 61, 182
BmiI GGNNCC 2 cut(s) 62, 63
BmrFI CCNGG 1 cut(s) 65
BmsI GCATC 2 cut(s) 58, 90
BpuMI CCSGG 1 cut(s) 65
BsaBI GATNNNNATC 1 cut(s) 303
Bse1I ACTGG 1 cut(s) 136
Bse8I GATNNNNATC 1 cut(s) 303
BseGI GGATG 1 cut(s) 317
BseJI GATNNNNATC 1 cut(s) 303
BseMII CTCAG 1 cut(s) 236
BseNI ACTGG 1 cut(s) 136
BsiSI CCGG 1 cut(s) 65
BslFI GGGAC 2 cut(s) 47, 47
BsmFI GGGAC 2 cut(s) 47, 47
Bsp143I GATC 4 cut(s) 22, 281, 298, 304
BspACI CCGC 1 cut(s) 265
BspCNI CTCAG 1 cut(s) 235
BspLI GGNNCC 2 cut(s) 62, 63
BspMAI CTGCAG 1 cut(s) 337
BspPI GGATC 2 cut(s) 17, 289
BsrI ACTGG 1 cut(s) 136
BssMI GATC 4 cut(s) 22, 281, 298, 304
BstC8I GCNNGC 4 cut(s) 6, 156, 192, 260
BstDEI CTNAG 1 cut(s) 222
BstF5I GGATG 1 cut(s) 317
BstKTI GATC 4 cut(s) 25, 284, 301, 307
BstMBI GATC 4 cut(s) 22, 281, 298, 304
BstMWI GCNNNNNNNGC 3 cut(s) 146, 155, 264
BstNSI RCATGY 1 cut(s) 262
BstSCI CCNGG 1 cut(s) 63
BstSFI CTRYAG 1 cut(s) 333
BstX2I RGATCY 1 cut(s) 22
BstYI RGATCY 1 cut(s) 22
BsuI GTATCC 1 cut(s) 121
BtrI CACGTC 1 cut(s) 376
BtsCI GGATG 1 cut(s) 317
BtsI GCAGTG 1 cut(s) 330
BtsIMutI CAGTG 1 cut(s) 330
Cac8I GCNNGC 4 cut(s) 6, 156, 192, 260
Cfr13I GGNCC 2 cut(s) 61, 182
CviAII CATG 4 cut(s) 203, 259, 308, 408
CviJI RGCY 1 cut(s) 149
CviKI_1 RGCY 1 cut(s) 149
DdeI CTNAG 1 cut(s) 222
DpnI GATC 4 cut(s) 24, 283, 300, 306
DpnII GATC 4 cut(s) 22, 281, 298, 304
DraI TTTAAA 1 cut(s) 345
Eco47I GGWCC 2 cut(s) 61, 182
Eco57I CTGAAG 1 cut(s) 105
EcoO109I RGGNCCY 1 cut(s) 61
FaeI CATG 4 cut(s) 206, 262, 311, 411
FaiI YATR 7 cut(s) 76, 204, 212, 260, 309, 409, 421
FalI AAGNNNNNCTT 2 cut(s) 138, 170
FaqI GGGAC 2 cut(s) 47, 47
FatI CATG 4 cut(s) 202, 258, 307, 407
FokI GGATG 1 cut(s) 324
FspBI CTAG 1 cut(s) 195
HapII CCGG 1 cut(s) 65
Hin1II CATG 4 cut(s) 206, 262, 311, 411
HindIII AAGCTT 1 cut(s) 147
HpaII CCGG 1 cut(s) 65
HphI GGTGA 2 cut(s) 257, 408
Hpy166II GTNNAC 1 cut(s) 288
Hpy188I TCNGA 2 cut(s) 298, 325
Hpy188III TCNNGA 3 cut(s) 43, 119, 302
Hpy8I GTNNAC 1 cut(s) 288
HpyAV CCTTC 1 cut(s) 332
HpyCH4IV ACGT 1 cut(s) 375
HpyCH4V TGCA 4 cut(s) 103, 262, 330, 335
HpyF10VI GCNNNNNNNGC 3 cut(s) 146, 155, 264
HpyF3I CTNAG 1 cut(s) 222
HpySE526I ACGT 1 cut(s) 375
Hsp92II CATG 4 cut(s) 206, 262, 311, 411
KflI GGGWCCC 1 cut(s) 61
Kzo9I GATC 4 cut(s) 22, 281, 298, 304
LpnPI CCDG 8 cut(s) 22, 38, 78, 104, 117, 209, 228, 408
LweI GCATC 2 cut(s) 58, 90
MaeI CTAG 1 cut(s) 195
MaeII ACGT 1 cut(s) 375
MaeIII GTNAC 2 cut(s) 245, 353
MalI GATC 4 cut(s) 24, 283, 300, 306
MboI GATC 4 cut(s) 22, 281, 298, 304
MboII GAAGA 3 cut(s) 32, 98, 109
MflI RGATCY 1 cut(s) 22
MluCI AATT 1 cut(s) 177
MnlI CCTC 1 cut(s) 191
MseI TTAA 1 cut(s) 344
MspI CCGG 1 cut(s) 65
MspR9I CCNGG 1 cut(s) 65
MwoI GCNNNNNNNGC 3 cut(s) 146, 155, 264
NciI CCSGG 1 cut(s) 65
NdeII GATC 4 cut(s) 22, 281, 298, 304
NlaIII CATG 4 cut(s) 206, 262, 311, 411
NlaIV GGNNCC 2 cut(s) 62, 63
NmuCI GTSAC 1 cut(s) 245
NspI RCATGY 1 cut(s) 262
PaeI GCATGC 1 cut(s) 262
PfoI TCCNGGA 1 cut(s) 63
PpuMI RGGWCCY 1 cut(s) 61
Psp5II RGGWCCY 1 cut(s) 61
PspN4I GGNNCC 2 cut(s) 62, 63
PspPI GGNCC 2 cut(s) 61, 182
PspPPI RGGWCCY 1 cut(s) 61
PstI CTGCAG 1 cut(s) 337
PsuI RGATCY 1 cut(s) 22
SaqAI TTAA 1 cut(s) 344
Sau3AI GATC 4 cut(s) 22, 281, 298, 304
Sau96I GGNCC 2 cut(s) 61, 182
ScrFI CCNGG 1 cut(s) 65
SetI ASST 6 cut(s) 151, 228, 343, 351, 378, 397
SfaNI GCATC 2 cut(s) 58, 90
SfcI CTRYAG 1 cut(s) 333
SinI GGWCC 2 cut(s) 61, 182
SphI GCATGC 1 cut(s) 262
Sse9I AATT 1 cut(s) 177
SsiI CCGC 1 cut(s) 265
SspMI CTAG 1 cut(s) 195
StyD4I CCNGG 1 cut(s) 63
TaiI ACGT 1 cut(s) 378
TasI AATT 1 cut(s) 177
Tru1I TTAA 1 cut(s) 344
Tru9I TTAA 1 cut(s) 344
TscAI CASTG 1 cut(s) 337
TseFI GTSAC 1 cut(s) 245
Tsp45I GTSAC 1 cut(s) 245
TspDTI ATGAA 2 cut(s) 110, 199
TspRI CASTG 1 cut(s) 337
VpaK11BI GGWCC 2 cut(s) 61, 182
XceI RCATGY 1 cut(s) 262
XspI CTAG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.