Rh5AG246100

Regulator of chromosome condensation (RCC1) repeat

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0000689
Physical Location & Seq
Forward (+)
30414135 .. 30417634
3500 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG246100.1

Sequence Viewer

Length: 429 bp
ATGATTCAAGTGGATATTGCTGCTGGGGGATGGCATTCTACTGCACTAACAGATGATGGAGAGGTGTATGGATGGGGCCGAGGGGAACATGGTAGACTTGGTTTCGGCGATAATGATAAGAGCAGTAAAATGGTCCCGCAAAAGGTTCATCTTTTAGCTGGGAAGGATATCGTTCAGGTGTCTTGTGGAGGCACTCACTCTGCTGCATTAACACGTGATGGGCGCATTTTCTCGATATTTTGTAAGGAGCCATTCTTCTATGGACATGATAACTACGATCAGCTAGTGAAACTAGCAAAGGTATGCATGCCGTTCACAAATCTGTCTTGTATATTTGCCTTTATTTATCTTATATGTTCAATCTACTGCCTCTGTCATGTTCAATTGCTTCCTGTGCCATCACTTTCCTTGCAGCAATTAGTAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RCC1

Protein Analysis

142

Amino Acids

15.64

Weight (kDa)

6.56

Isoelectric Point (pI)

39.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WD40_RLD PF25390 4 - 88 9.1e-23 RCC1-like domain
RCC1_2 PF13540 4 - 31 9e-11 Regulator of chromosome condensation (RCC1) repeat
RCC1 PF00415 19 - 70 5.2e-18 Regulator of chromosome condensation (RCC1) repeat
RCC1_2 PF13540 57 - 78 1.9e-06 Regulator of chromosome condensation (RCC1) repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000689)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08040
malus_domestica MD09G1245800.v1.1 MD11G1098500.v1.1 MD16G1237300.v1.1
pyrus_communis pycom03g07090 pycom03g07100 pycom09g08560 pycom13g20460 pycom16g19890
rosa_chinensis RchiOBHm_Chr2g0118961 RchiOBHm_Chr2g0148671 RchiOBHm_Chr2g0150531 RchiOBHm_Chr2g0171301 RchiOBHm_Chr3g0455021 RchiOBHm_Chr6g0249451
rosa_laevigata RLG00000001225 RLG00000001972 RLG00000008936 RLG00000009011 RLG00000009032 RLG00000015372 RLG00000019992 RLG00000020680 RLG00000026543
rosa_multiflora Rmu_co8272705.1_g000001 Rmu_co8286409.1_g000001 Rmu_sc0000048.1_g000034 Rmu_sc0000824.1_g000002 Rmu_sc0001839.1_g000023 Rmu_sc0002070.1_g000050 Rmu_sc0002349.1_g000005 Rmu_sc0002453.1_g000019 Rmu_sc0006431.1_g000026 Rmu_sc0006758.1_g000001 Rmu_sc0006758.1_g000013 Rmu_sc0006997.1_g000015 Rmu_sc0008411.1_g000007 Rmu_sc0008411.1_g000019 Rmu_sc0008411.1_g000028 Rmu_sc0008678.1_g000001
rosa_roxburghii Rroxscaffold_3G00225850 Rroxscaffold_3G00225860 Rroxscaffold_3G00233460 Rroxscaffold_3G00234260 Rroxscaffold_3G00236880 Rroxscaffold_3G00236890 Rroxscaffold_4G00294300 Rroxscaffold_4G00297380 Rroxscaffold_4G00324650 Rroxscaffold_5G00352840 Rroxscaffold_5G00354640 Rroxscaffold_5G00361500 Rroxscaffold_7G00156410 Rroxscaffold_7G00156420 Rroxscaffold_7G00198110 Rroxscaffold_7G00198120
rosa_samantha Rh1CG014400 Rh1DG009900 Rh2AG465900 Rh2BG342900 Rh2CG452400 Rh2DG488000 Rh3DG303300 Rh4AG118000 Rh4DG159500 Rh5AG246100 Rh6AG232100 Rh6BG178700 Rh6DG174100 Rh7BG231200 Rh7DG380300
rosa_wichuraiana Rw2G027640 Rw2G038070 Rw6G005920 Rw7G034430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 94
AciI CCGC 1 cut(s) 137
AcvI CACGTG 1 cut(s) 215
AfiI CCNNNNNNNGG 1 cut(s) 142
AflIII ACRYGT 1 cut(s) 212
AgsI TTSAA 3 cut(s) 8, 360, 383
AluBI AGCT 2 cut(s) 158, 283
AluI AGCT 2 cut(s) 158, 283
AoxI GGCC 1 cut(s) 76
ApeKI GCWGC 3 cut(s) 20, 203, 412
AspLEI GCGC 1 cut(s) 225
AspS9I GGNCC 2 cut(s) 76, 133
AvaII GGWCC 1 cut(s) 133
BbrPI CACGTG 1 cut(s) 215
BbvI GCAGC 3 cut(s) 7, 190, 424
BccI CCATC 5 cut(s) 24, 50, 66, 212, 406
BceAI ACGGC 1 cut(s) 295
BfaI CTAG 2 cut(s) 284, 293
BisI GCNGC 3 cut(s) 21, 204, 413
BlsI GCNGC 3 cut(s) 22, 205, 414
Bme18I GGWCC 1 cut(s) 133
BmgT120I GGNCC 2 cut(s) 76, 133
BmiI GGNNCC 3 cut(s) 77, 135, 249
BsaAI YACGTR 1 cut(s) 215
BsaJI CCNNGG 1 cut(s) 79
Bsc4I CCNNNNNNNGG 1 cut(s) 142
BseDI CCNNGG 1 cut(s) 79
BseGI GGATG 2 cut(s) 35, 77
BseLI CCNNNNNNNGG 1 cut(s) 142
BseXI GCAGC 3 cut(s) 7, 190, 424
BseYI CCCAGC 2 cut(s) 23, 158
BsgI GTGCAG 1 cut(s) 27
BshFI GGCC 1 cut(s) 78
BslFI GGGAC 1 cut(s) 119
BslI CCNNNNNNNGG 1 cut(s) 142
BsmFI GGGAC 1 cut(s) 119
BsmI GAATGC 1 cut(s) 34
BsnI GGCC 1 cut(s) 78
Bsp143I GATC 1 cut(s) 277
BspACI CCGC 1 cut(s) 137
BspANI GGCC 1 cut(s) 78
BspLI GGNNCC 3 cut(s) 77, 135, 249
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 1 cut(s) 277
BstBAI YACGTR 1 cut(s) 215
BstC8I GCNNGC 1 cut(s) 308
BstF5I GGATG 2 cut(s) 35, 77
BstHHI GCGC 1 cut(s) 225
BstKTI GATC 1 cut(s) 280
BstMBI GATC 1 cut(s) 277
BstMWI GCNNNNNNNGC 1 cut(s) 394
BstNSI RCATGY 1 cut(s) 310
BstV1I GCAGC 3 cut(s) 7, 190, 424
BsuRI GGCC 1 cut(s) 78
BtsCI GGATG 2 cut(s) 35, 77
Cac8I GCNNGC 1 cut(s) 308
CfoI GCGC 1 cut(s) 225
Cfr13I GGNCC 2 cut(s) 76, 133
CviAII CATG 4 cut(s) 89, 266, 307, 377
CviJI RGCY 4 cut(s) 78, 158, 250, 283
CviKI_1 RGCY 4 cut(s) 78, 158, 250, 283
DpnI GATC 1 cut(s) 279
DpnII GATC 1 cut(s) 277
Eco32I GATATC 1 cut(s) 169
Eco47I GGWCC 1 cut(s) 133
Eco72I CACGTG 1 cut(s) 215
EcoRV GATATC 1 cut(s) 169
EcoT22I ATGCAT 1 cut(s) 308
FaeI CATG 4 cut(s) 92, 269, 310, 380
FaqI GGGAC 1 cut(s) 119
FatI CATG 4 cut(s) 88, 265, 306, 376
FauI CCCGC 1 cut(s) 144
FblI GTMKAC 1 cut(s) 94
Fnu4HI GCNGC 3 cut(s) 21, 204, 413
FokI GGATG 2 cut(s) 42, 84
Fsp4HI GCNGC 3 cut(s) 21, 204, 413
FspBI CTAG 2 cut(s) 284, 293
GlaI GCGC 1 cut(s) 224
GluI GCNGC 3 cut(s) 21, 204, 413
GsaI CCCAGC 2 cut(s) 27, 162
HaeIII GGCC 1 cut(s) 78
HhaI GCGC 1 cut(s) 225
Hin1II CATG 4 cut(s) 92, 269, 310, 380
Hin6I GCGC 1 cut(s) 223
HinP1I GCGC 1 cut(s) 223
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 2 cut(s) 95, 315
Hpy188III TCNNGA 1 cut(s) 232
Hpy8I GTNNAC 2 cut(s) 95, 315
HpyAV CCTTC 1 cut(s) 157
HpyCH4IV ACGT 1 cut(s) 214
HpyCH4V TGCA 4 cut(s) 44, 206, 306, 412
HpyF10VI GCNNNNNNNGC 1 cut(s) 394
HpySE526I ACGT 1 cut(s) 214
Hsp92II CATG 4 cut(s) 92, 269, 310, 380
HspAI GCGC 1 cut(s) 223
Kzo9I GATC 1 cut(s) 277
LmnI GCTCC 1 cut(s) 247
LpnPI CCDG 4 cut(s) 9, 144, 161, 405
Lsp1109I GCAGC 3 cut(s) 7, 190, 424
MaeI CTAG 2 cut(s) 284, 293
MaeII ACGT 1 cut(s) 214
MalI GATC 1 cut(s) 279
MboI GATC 1 cut(s) 277
MboII GAAGA 1 cut(s) 247
MfeI CAATTG 1 cut(s) 383
MluCI AATT 2 cut(s) 383, 416
MnlI CCTC 4 cut(s) 55, 74, 182, 380
Mph1103I ATGCAT 1 cut(s) 308
MseI TTAA 1 cut(s) 209
MunI CAATTG 1 cut(s) 383
Mva1269I GAATGC 1 cut(s) 34
MwoI GCNNNNNNNGC 1 cut(s) 394
NdeII GATC 1 cut(s) 277
NlaIII CATG 4 cut(s) 92, 269, 310, 380
NlaIV GGNNCC 3 cut(s) 77, 135, 249
NmeAIII GCCGAG 1 cut(s) 104
NsiI ATGCAT 1 cut(s) 308
NspI RCATGY 1 cut(s) 310
PaeI GCATGC 1 cut(s) 310
PctI GAATGC 1 cut(s) 34
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 3 cut(s) 22, 205, 414
PmaCI CACGTG 1 cut(s) 215
PmlI CACGTG 1 cut(s) 215
Ppu21I YACGTR 1 cut(s) 215
PspCI CACGTG 1 cut(s) 215
PspFI CCCAGC 2 cut(s) 23, 158
PspN4I GGNNCC 3 cut(s) 77, 135, 249
PspPI GGNCC 2 cut(s) 76, 133
SaqAI TTAA 1 cut(s) 209
SatI GCNGC 3 cut(s) 21, 204, 413
Sau3AI GATC 1 cut(s) 277
Sau96I GGNCC 2 cut(s) 76, 133
SetI ASST 7 cut(s) 66, 147, 160, 180, 217, 285, 303
SinI GGWCC 1 cut(s) 133
SphI GCATGC 1 cut(s) 310
Sse9I AATT 2 cut(s) 383, 416
SsiI CCGC 1 cut(s) 137
SspMI CTAG 2 cut(s) 284, 293
TaiI ACGT 1 cut(s) 217
TaqI TCGA 1 cut(s) 233
TasI AATT 2 cut(s) 383, 416
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 209
Tru9I TTAA 1 cut(s) 209
TseI GCWGC 3 cut(s) 20, 203, 412
TspDTI ATGAA 1 cut(s) 137
VpaK11BI GGWCC 1 cut(s) 133
XceI RCATGY 1 cut(s) 310
XmiI GTMKAC 1 cut(s) 94
XspI CTAG 2 cut(s) 284, 293
Zsp2I ATGCAT 1 cut(s) 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.