Rmu_sc0002070.1_g000050

Belongs to the terpene cyclase mutase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002070.1
OG0000689
Physical Location & Seq
Reverse (-)
234306 .. 235496
1191 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002070.1_g000050.1.cds

Sequence Viewer

Length: 723 bp
atgtactgctactgccggttgacttacttgcctatgtcgcatctgtttgggaaaagatttgttggccccatcacccctctcattctacaactgagagaagaaatgtacaatgagccatacaatgaaattcaatggggcaaagtacgccatctttgtgcaaaggaggataactacaatccccatggcaagttacaatgtttgttgtgggatactctgaacacagtttatgagcctcttctttcttgctggcccttcaataagttgagagagaaggctcttcaagaaactattgaacacattcattatgaagatgaaaatagtagatacataacaattggatgtgcggaaaagccattaatgatgcttgcttgctggattgaagatccgaatggagaaccctttaagaagcatcttgcaagagttatagattacatatgggttgcagaagatggaataactacgcagagttttggtagccaggcatgggatgctagtctttctgttcaagctttgcttgctggaaatcacactgatgaacttggatctgttagggataatccttctggtgacttcttagctcatttccgtcacatttctaaaggtgcttggactttgtctgaccgagatcatggatggcaagtttctgattgtactgcagagggtttgaaggtgacttttcaatcctgcgcttttctggaattgaggactaagcctcatttataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00909 ko01110 map00909 map01110
Pfam Domains
Protein Families
SQHop_cyclase_C SQHop_cyclase_N

Protein Analysis

240

Amino Acids

27.75

Weight (kDa)

5.75

Isoelectric Point (pI)

47.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000689)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08040
malus_domestica MD09G1245800.v1.1 MD11G1098500.v1.1 MD16G1237300.v1.1
pyrus_communis pycom03g07090 pycom03g07100 pycom09g08560 pycom13g20460 pycom16g19890
rosa_chinensis RchiOBHm_Chr2g0118961 RchiOBHm_Chr2g0148671 RchiOBHm_Chr2g0150531 RchiOBHm_Chr2g0171301 RchiOBHm_Chr3g0455021 RchiOBHm_Chr6g0249451
rosa_laevigata RLG00000001225 RLG00000001972 RLG00000008936 RLG00000009011 RLG00000009032 RLG00000015372 RLG00000019992 RLG00000020680 RLG00000026543
rosa_multiflora Rmu_co8272705.1_g000001 Rmu_co8286409.1_g000001 Rmu_sc0000048.1_g000034 Rmu_sc0000824.1_g000002 Rmu_sc0001839.1_g000023 Rmu_sc0002070.1_g000050 Rmu_sc0002349.1_g000005 Rmu_sc0002453.1_g000019 Rmu_sc0006431.1_g000026 Rmu_sc0006758.1_g000001 Rmu_sc0006758.1_g000013 Rmu_sc0006997.1_g000015 Rmu_sc0008411.1_g000007 Rmu_sc0008411.1_g000019 Rmu_sc0008411.1_g000028 Rmu_sc0008678.1_g000001
rosa_roxburghii Rroxscaffold_3G00225850 Rroxscaffold_3G00225860 Rroxscaffold_3G00233460 Rroxscaffold_3G00234260 Rroxscaffold_3G00236880 Rroxscaffold_3G00236890 Rroxscaffold_4G00294300 Rroxscaffold_4G00297380 Rroxscaffold_4G00324650 Rroxscaffold_5G00352840 Rroxscaffold_5G00354640 Rroxscaffold_5G00361500 Rroxscaffold_7G00156410 Rroxscaffold_7G00156420 Rroxscaffold_7G00198110 Rroxscaffold_7G00198120
rosa_samantha Rh1CG014400 Rh1DG009900 Rh2AG465900 Rh2BG342900 Rh2CG452400 Rh2DG488000 Rh3DG303300 Rh4AG118000 Rh4DG159500 Rh5AG246100 Rh6AG232100 Rh6BG178700 Rh6DG174100 Rh7BG231200 Rh7DG380300
rosa_wichuraiana Rw2G027640 Rw2G038070 Rw6G005920 Rw7G034430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 721
AciI CCGC 1 cut(s) 344
AclWI GGATC 2 cut(s) 377, 550
AcsI RAATTY 1 cut(s) 126
AfaI GTAC 4 cut(s) 5, 107, 144, 652
AfiI CCNNNNNNNGG 1 cut(s) 484
AgsI TTSAA 8 cut(s) 131, 256, 281, 293, 380, 506, 667, 680
AjnI CCWGG 1 cut(s) 477
AluBI AGCT 2 cut(s) 509, 578
AluI AGCT 2 cut(s) 509, 578
AlwI GGATC 2 cut(s) 377, 550
AoxI GGCC 2 cut(s) 64, 248
ApoI RAATTY 1 cut(s) 126
AseI ATTAAT 1 cut(s) 356
Asp700I GAANNNNTTC 1 cut(s) 297
AspLEI GCGC 1 cut(s) 689
AspS9I GGNCC 2 cut(s) 65, 249
AsuHPI GGTGA 3 cut(s) 64, 578, 682
BccI CCATC 4 cut(s) 77, 156, 443, 627
BciT130I CCWGG 1 cut(s) 479
BciVI GTATCC 1 cut(s) 202
BfaI CTAG 1 cut(s) 492
BfmI CTRYAG 1 cut(s) 654
BfuI GTATCC 1 cut(s) 202
Bme1390I CCNGG 1 cut(s) 479
BmgT120I GGNCC 2 cut(s) 65, 249
BmiI GGNNCC 1 cut(s) 67
BmrFI CCNGG 1 cut(s) 479
BmsI GCATC 4 cut(s) 49, 351, 418, 478
BsaJI CCNNGG 1 cut(s) 181
Bsc4I CCNNNNNNNGG 1 cut(s) 484
Bse118I RCCGGY 1 cut(s) 15
BseBI CCWGG 1 cut(s) 479
BseDI CCNNGG 1 cut(s) 181
BseGI GGATG 3 cut(s) 344, 493, 638
BseLI CCNNNNNNNGG 1 cut(s) 484
BseMII CTCAG 1 cut(s) 83
BshFI GGCC 2 cut(s) 66, 250
BsiSI CCGG 1 cut(s) 16
BslI CCNNNNNNNGG 1 cut(s) 484
BsnI GGCC 2 cut(s) 66, 250
Bsp1407I TGTACA 1 cut(s) 105
Bsp143I GATC 3 cut(s) 382, 542, 625
Bsp19I CCATGG 1 cut(s) 181
BspACI CCGC 1 cut(s) 344
BspANI GGCC 2 cut(s) 66, 250
BspCNI CTCAG 1 cut(s) 84
BspLI GGNNCC 1 cut(s) 67
BspMAI CTGCAG 1 cut(s) 658
BspPI GGATC 2 cut(s) 377, 550
BspQI GCTCTTC 1 cut(s) 282
BsrFI RCCGGY 1 cut(s) 15
BsrGI TGTACA 1 cut(s) 105
BssAI RCCGGY 1 cut(s) 15
BssECI CCNNGG 1 cut(s) 181
BssMI GATC 3 cut(s) 382, 542, 625
BssT1I CCWWGG 1 cut(s) 181
Bst2UI CCWGG 1 cut(s) 479
Bst4CI ACNGT 1 cut(s) 223
Bst6I CTCTTC 2 cut(s) 240, 282
BstAPI GCANNNNNTGC 1 cut(s) 488
BstAUI TGTACA 1 cut(s) 105
BstC8I GCNNGC 4 cut(s) 248, 366, 370, 516
BstDEI CTNAG 3 cut(s) 92, 574, 708
BstDSI CCRYGG 1 cut(s) 181
BstF5I GGATG 3 cut(s) 344, 493, 638
BstHHI GCGC 1 cut(s) 689
BstKTI GATC 3 cut(s) 385, 545, 628
BstMBI GATC 3 cut(s) 382, 542, 625
BstMWI GCNNNNNNNGC 4 cut(s) 37, 144, 488, 515
BstNI CCWGG 1 cut(s) 479
BstSCI CCNGG 1 cut(s) 477
BstSFI CTRYAG 1 cut(s) 654
BstX2I RGATCY 2 cut(s) 382, 542
BstYI RGATCY 2 cut(s) 382, 542
BsuI GTATCC 1 cut(s) 202
BsuRI GGCC 2 cut(s) 66, 250
BtgI CCRYGG 1 cut(s) 181
BtsCI GGATG 3 cut(s) 344, 493, 638
BtsIMutI CAGTG 1 cut(s) 528
Cac8I GCNNGC 4 cut(s) 248, 366, 370, 516
CfoI GCGC 1 cut(s) 689
Cfr10I RCCGGY 1 cut(s) 15
Cfr13I GGNCC 2 cut(s) 65, 249
Csp6I GTAC 4 cut(s) 4, 106, 143, 651
CviAII CATG 3 cut(s) 182, 483, 629
CviQI GTAC 4 cut(s) 4, 106, 143, 651
DdeI CTNAG 3 cut(s) 92, 574, 708
DpnI GATC 3 cut(s) 384, 544, 627
DpnII GATC 3 cut(s) 382, 542, 625
Eam1104I CTCTTC 2 cut(s) 240, 282
EarI CTCTTC 2 cut(s) 240, 282
Eco130I CCWWGG 1 cut(s) 181
EcoRII CCWGG 1 cut(s) 477
EcoT14I CCWWGG 1 cut(s) 181
ErhI CCWWGG 1 cut(s) 181
FaeI CATG 3 cut(s) 185, 486, 632
FalI AAGNNNNNCTT 2 cut(s) 498, 530
FatI CATG 3 cut(s) 181, 482, 628
FauNDI CATATG 1 cut(s) 434
FokI GGATG 3 cut(s) 351, 500, 645
FspBI CTAG 1 cut(s) 492
GlaI GCGC 1 cut(s) 688
HaeIII GGCC 2 cut(s) 66, 250
HapII CCGG 1 cut(s) 16
HhaI GCGC 1 cut(s) 689
Hin1II CATG 3 cut(s) 185, 486, 632
Hin6I GCGC 1 cut(s) 687
HinP1I GCGC 1 cut(s) 687
HincII GTYRAC 1 cut(s) 21
HindII GTYRAC 1 cut(s) 21
HindIII AAGCTT 1 cut(s) 507
HpaII CCGG 1 cut(s) 16
HphI GGTGA 3 cut(s) 64, 578, 682
Hpy166II GTNNAC 1 cut(s) 21
Hpy188I TCNGA 4 cut(s) 216, 387, 619, 646
Hpy188III TCNNGA 2 cut(s) 281, 695
Hpy8I GTNNAC 1 cut(s) 21
HpyAV CCTTC 4 cut(s) 262, 265, 570, 661
HpyCH4III ACNGT 1 cut(s) 223
HpyCH4V TGCA 4 cut(s) 158, 416, 443, 656
HpyF10VI GCNNNNNNNGC 4 cut(s) 37, 144, 488, 515
HpyF3I CTNAG 3 cut(s) 92, 574, 708
Hsp92II CATG 3 cut(s) 185, 486, 632
HspAI GCGC 1 cut(s) 687
Kzo9I GATC 3 cut(s) 382, 542, 625
LguI GCTCTTC 1 cut(s) 282
LpnPI CCDG 9 cut(s) 29, 232, 358, 464, 491, 504, 549, 680, 697
LweI GCATC 4 cut(s) 49, 351, 418, 478
MaeI CTAG 1 cut(s) 492
MaeIII GTNAC 4 cut(s) 189, 566, 587, 670
MalI GATC 3 cut(s) 384, 544, 627
MboI GATC 3 cut(s) 382, 542, 625
MboII GAAGA 6 cut(s) 110, 227, 269, 320, 392, 458
MfeI CAATTG 1 cut(s) 333
MflI RGATCY 2 cut(s) 382, 542
MluCI AATT 3 cut(s) 126, 333, 698
MnlI CCTC 6 cut(s) 87, 157, 243, 652, 696, 723
MroXI GAANNNNTTC 1 cut(s) 297
MseI TTAA 2 cut(s) 356, 402
MslI CAYNNNNRTG 2 cut(s) 153, 531
MspI CCGG 1 cut(s) 16
MspR9I CCNGG 1 cut(s) 479
MunI CAATTG 1 cut(s) 333
MvaI CCWGG 1 cut(s) 479
MwoI GCNNNNNNNGC 4 cut(s) 37, 144, 488, 515
NcoI CCATGG 1 cut(s) 181
NdeI CATATG 1 cut(s) 434
NdeII GATC 3 cut(s) 382, 542, 625
NlaIII CATG 3 cut(s) 185, 486, 632
NlaIV GGNNCC 1 cut(s) 67
NmuCI GTSAC 3 cut(s) 566, 587, 670
PciSI GCTCTTC 1 cut(s) 282
PdmI GAANNNNTTC 1 cut(s) 297
PflFI GACNNNGTC 1 cut(s) 613
PshBI ATTAAT 1 cut(s) 356
PsiI TTATAA 1 cut(s) 721
Psp6I CCWGG 1 cut(s) 477
PspGI CCWGG 1 cut(s) 477
PspN4I GGNNCC 1 cut(s) 67
PspPI GGNCC 2 cut(s) 65, 249
PstI CTGCAG 1 cut(s) 658
PsuI RGATCY 2 cut(s) 382, 542
PsyI GACNNNGTC 1 cut(s) 613
RsaI GTAC 4 cut(s) 5, 107, 144, 652
RsaNI GTAC 4 cut(s) 4, 106, 143, 651
RseI CAYNNNNRTG 2 cut(s) 153, 531
SapI GCTCTTC 1 cut(s) 282
SaqAI TTAA 2 cut(s) 356, 402
Sau3AI GATC 3 cut(s) 382, 542, 625
Sau96I GGNCC 2 cut(s) 65, 249
ScrFI CCNGG 1 cut(s) 479
SetI ASST 4 cut(s) 511, 580, 604, 672
SfaNI GCATC 4 cut(s) 49, 351, 418, 478
SfcI CTRYAG 1 cut(s) 654
SmiMI CAYNNNNRTG 2 cut(s) 153, 531
Sse9I AATT 3 cut(s) 126, 333, 698
SsiI CCGC 1 cut(s) 344
SspMI CTAG 1 cut(s) 492
StyD4I CCNGG 1 cut(s) 477
StyI CCWWGG 1 cut(s) 181
TaaI ACNGT 1 cut(s) 223
TaqII GACCGA 1 cut(s) 636
TasI AATT 3 cut(s) 126, 333, 698
TatI WGTACW 3 cut(s) 3, 105, 650
Tru1I TTAA 2 cut(s) 356, 402
Tru9I TTAA 2 cut(s) 356, 402
TscAI CASTG 1 cut(s) 535
TseFI GTSAC 3 cut(s) 566, 587, 670
Tsp45I GTSAC 3 cut(s) 566, 587, 670
TspDTI ATGAA 5 cut(s) 138, 290, 321, 327, 549
TspGWI ACGGA 1 cut(s) 575
TspRI CASTG 1 cut(s) 535
Tth111I GACNNNGTC 1 cut(s) 613
VspI ATTAAT 1 cut(s) 356
XapI RAATTY 1 cut(s) 126
XmnI GAANNNNTTC 1 cut(s) 297
XspI CTAG 1 cut(s) 492
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.