Rh4DG159500

Regulator of chromosome condensation (RCC1) repeat

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0000689
Physical Location & Seq
Reverse (-)
31759716 .. 31774669
14954 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG159500.1

Sequence Viewer

Length: 423 bp
ATGATTCAAGTGGATATTGCTGCTGGATGGCATTCTACTGCACTAACAGATGATGGAGAGGTGTATGGATGGGGCCGAGGGGAACATGGTAGACTTGGTTTCGGCGAGAATGATAAGAGCAGTAAAATGGTCCAGCAAAAGGTTCATCTTTTAGCTGGGGAGGATATCGTTCAGGTGTCTTGTGGAGGCACTCACTCTGCTGCATTAACATGTGATGGGCGCATTTTCTCGATATTTTGTAAGGAGCCATTCTTCTATGGACATGATAACTACGATCAGCTAGTGAAACTAGCAAAGGCAAGGTATGCATGCCGTTCACGAATATGTCTTGTATATTTGCCTTTATTTATCTTATATGGTCAATCTACTGCCTCTGTCATGTTCAATTGCTTCCTGTGCCATCACTTTCCTTGTAGCAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RCC1

Protein Analysis

140

Amino Acids

15.59

Weight (kDa)

6.63

Isoelectric Point (pI)

36.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WD40_RLD PF25390 5 - 78 2.2e-19 RCC1-like domain
RCC1_2 PF13540 5 - 30 3e-07 Regulator of chromosome condensation (RCC1) repeat
RCC1 PF00415 18 - 69 1.2e-13 Regulator of chromosome condensation (RCC1) repeat
RCC1_2 PF13540 56 - 77 7.6e-06 Regulator of chromosome condensation (RCC1) repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000689)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08040
malus_domestica MD09G1245800.v1.1 MD11G1098500.v1.1 MD16G1237300.v1.1
pyrus_communis pycom03g07090 pycom03g07100 pycom09g08560 pycom13g20460 pycom16g19890
rosa_chinensis RchiOBHm_Chr2g0118961 RchiOBHm_Chr2g0148671 RchiOBHm_Chr2g0150531 RchiOBHm_Chr2g0171301 RchiOBHm_Chr3g0455021 RchiOBHm_Chr6g0249451
rosa_laevigata RLG00000001225 RLG00000001972 RLG00000008936 RLG00000009011 RLG00000009032 RLG00000015372 RLG00000019992 RLG00000020680 RLG00000026543
rosa_multiflora Rmu_co8272705.1_g000001 Rmu_co8286409.1_g000001 Rmu_sc0000048.1_g000034 Rmu_sc0000824.1_g000002 Rmu_sc0001839.1_g000023 Rmu_sc0002070.1_g000050 Rmu_sc0002349.1_g000005 Rmu_sc0002453.1_g000019 Rmu_sc0006431.1_g000026 Rmu_sc0006758.1_g000001 Rmu_sc0006758.1_g000013 Rmu_sc0006997.1_g000015 Rmu_sc0008411.1_g000007 Rmu_sc0008411.1_g000019 Rmu_sc0008411.1_g000028 Rmu_sc0008678.1_g000001
rosa_roxburghii Rroxscaffold_3G00225850 Rroxscaffold_3G00225860 Rroxscaffold_3G00233460 Rroxscaffold_3G00234260 Rroxscaffold_3G00236880 Rroxscaffold_3G00236890 Rroxscaffold_4G00294300 Rroxscaffold_4G00297380 Rroxscaffold_4G00324650 Rroxscaffold_5G00352840 Rroxscaffold_5G00354640 Rroxscaffold_5G00361500 Rroxscaffold_7G00156410 Rroxscaffold_7G00156420 Rroxscaffold_7G00198110 Rroxscaffold_7G00198120
rosa_samantha Rh1CG014400 Rh1DG009900 Rh2AG465900 Rh2BG342900 Rh2CG452400 Rh2DG488000 Rh3DG303300 Rh4AG118000 Rh4DG159500 Rh5AG246100 Rh6AG232100 Rh6BG178700 Rh6DG174100 Rh7BG231200 Rh7DG380300
rosa_wichuraiana Rw2G027640 Rw2G038070 Rw6G005920 Rw7G034430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 139
AflIII ACRYGT 1 cut(s) 209
AgsI TTSAA 2 cut(s) 8, 385
AluBI AGCT 2 cut(s) 155, 280
AluI AGCT 2 cut(s) 155, 280
AoxI GGCC 1 cut(s) 73
ApeKI GCWGC 2 cut(s) 20, 200
AspLEI GCGC 1 cut(s) 222
AspS9I GGNCC 2 cut(s) 73, 130
AvaII GGWCC 1 cut(s) 130
BbvI GCAGC 2 cut(s) 7, 187
BccI CCATC 5 cut(s) 21, 47, 63, 209, 408
BceAI ACGGC 1 cut(s) 297
BfaI CTAG 2 cut(s) 281, 290
BisI GCNGC 2 cut(s) 21, 201
BlsI GCNGC 2 cut(s) 22, 202
Bme18I GGWCC 1 cut(s) 130
BmgT120I GGNCC 2 cut(s) 73, 130
BmiI GGNNCC 2 cut(s) 74, 246
BsaJI CCNNGG 1 cut(s) 76
Bsc4I CCNNNNNNNGG 1 cut(s) 139
BseDI CCNNGG 1 cut(s) 76
BseGI GGATG 2 cut(s) 32, 74
BseLI CCNNNNNNNGG 1 cut(s) 139
BseXI GCAGC 2 cut(s) 7, 187
BseYI CCCAGC 1 cut(s) 155
BsgI GTGCAG 1 cut(s) 24
BshFI GGCC 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 139
BsmI GAATGC 1 cut(s) 31
BsnI GGCC 1 cut(s) 75
Bsp143I GATC 1 cut(s) 274
BspANI GGCC 1 cut(s) 75
BspLI GGNNCC 2 cut(s) 74, 246
BssECI CCNNGG 1 cut(s) 76
BssMI GATC 1 cut(s) 274
BstAPI GCANNNNNTGC 1 cut(s) 305
BstC8I GCNNGC 1 cut(s) 310
BstF5I GGATG 2 cut(s) 32, 74
BstHHI GCGC 1 cut(s) 222
BstKTI GATC 1 cut(s) 277
BstMBI GATC 1 cut(s) 274
BstMWI GCNNNNNNNGC 2 cut(s) 305, 396
BstNSI RCATGY 2 cut(s) 213, 312
BstV1I GCAGC 2 cut(s) 7, 187
BsuRI GGCC 1 cut(s) 75
BtsCI GGATG 2 cut(s) 32, 74
Cac8I GCNNGC 1 cut(s) 310
CfoI GCGC 1 cut(s) 222
Cfr13I GGNCC 2 cut(s) 73, 130
CviAII CATG 5 cut(s) 86, 210, 263, 309, 379
CviJI RGCY 4 cut(s) 75, 155, 247, 280
CviKI_1 RGCY 4 cut(s) 75, 155, 247, 280
DpnI GATC 1 cut(s) 276
DpnII GATC 1 cut(s) 274
Eco32I GATATC 1 cut(s) 166
Eco47I GGWCC 1 cut(s) 130
EcoRV GATATC 1 cut(s) 166
EcoT22I ATGCAT 1 cut(s) 310
FaeI CATG 5 cut(s) 89, 213, 266, 312, 382
FatI CATG 5 cut(s) 85, 209, 262, 308, 378
FblI GTMKAC 1 cut(s) 91
Fnu4HI GCNGC 2 cut(s) 21, 201
FokI GGATG 2 cut(s) 39, 81
Fsp4HI GCNGC 2 cut(s) 21, 201
FspBI CTAG 2 cut(s) 281, 290
GlaI GCGC 1 cut(s) 221
GluI GCNGC 2 cut(s) 21, 201
GsaI CCCAGC 1 cut(s) 159
HaeIII GGCC 1 cut(s) 75
HhaI GCGC 1 cut(s) 222
Hin1II CATG 5 cut(s) 89, 213, 266, 312, 382
Hin6I GCGC 1 cut(s) 220
HinP1I GCGC 1 cut(s) 220
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 2 cut(s) 92, 317
Hpy188III TCNNGA 2 cut(s) 229, 318
Hpy8I GTNNAC 2 cut(s) 92, 317
HpyCH4V TGCA 3 cut(s) 41, 203, 308
HpyF10VI GCNNNNNNNGC 2 cut(s) 305, 396
Hsp92II CATG 5 cut(s) 89, 213, 266, 312, 382
HspAI GCGC 1 cut(s) 220
Kzo9I GATC 1 cut(s) 274
LmnI GCTCC 1 cut(s) 244
LpnPI CCDG 5 cut(s) 9, 141, 146, 158, 407
Lsp1109I GCAGC 2 cut(s) 7, 187
MaeI CTAG 2 cut(s) 281, 290
MalI GATC 1 cut(s) 276
MboI GATC 1 cut(s) 274
MboII GAAGA 1 cut(s) 244
MfeI CAATTG 1 cut(s) 385
MluCI AATT 2 cut(s) 385, 418
MnlI CCTC 5 cut(s) 52, 71, 154, 179, 382
Mph1103I ATGCAT 1 cut(s) 310
MseI TTAA 1 cut(s) 206
MslI CAYNNNNRTG 2 cut(s) 208, 322
MunI CAATTG 1 cut(s) 385
Mva1269I GAATGC 1 cut(s) 31
MwoI GCNNNNNNNGC 2 cut(s) 305, 396
NdeII GATC 1 cut(s) 274
NlaIII CATG 5 cut(s) 89, 213, 266, 312, 382
NlaIV GGNNCC 2 cut(s) 74, 246
NmeAIII GCCGAG 1 cut(s) 101
NsiI ATGCAT 1 cut(s) 310
NspI RCATGY 2 cut(s) 213, 312
PaeI GCATGC 1 cut(s) 312
PciI ACATGT 1 cut(s) 209
PctI GAATGC 1 cut(s) 31
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 2 cut(s) 22, 202
PscI ACATGT 1 cut(s) 209
PspFI CCCAGC 1 cut(s) 155
PspN4I GGNNCC 2 cut(s) 74, 246
PspPI GGNCC 2 cut(s) 73, 130
RseI CAYNNNNRTG 2 cut(s) 208, 322
SaqAI TTAA 1 cut(s) 206
SatI GCNGC 2 cut(s) 21, 201
Sau3AI GATC 1 cut(s) 274
Sau96I GGNCC 2 cut(s) 73, 130
SetI ASST 6 cut(s) 63, 144, 157, 177, 282, 305
SinI GGWCC 1 cut(s) 130
SmiMI CAYNNNNRTG 2 cut(s) 208, 322
SphI GCATGC 1 cut(s) 312
Sse9I AATT 2 cut(s) 385, 418
SspMI CTAG 2 cut(s) 281, 290
TaqI TCGA 1 cut(s) 230
TasI AATT 2 cut(s) 385, 418
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 206
Tru9I TTAA 1 cut(s) 206
TseI GCWGC 2 cut(s) 20, 200
TspDTI ATGAA 1 cut(s) 134
VpaK11BI GGWCC 1 cut(s) 130
XceI RCATGY 2 cut(s) 213, 312
XmiI GTMKAC 1 cut(s) 91
XspI CTAG 2 cut(s) 281, 290
Zsp2I ATGCAT 1 cut(s) 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.