RLG00000009032

Regulator of chromosome condensation (RCC1) repeat

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0000689
Physical Location & Seq
Reverse (-)
45352180 .. 45356876
4697 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000009032

Sequence Viewer

Length: 546 bp
ATGCCTTATCTCCAGGCCTCCACCAAGATGGCTTTGGAATCCCATACATTTGGATCGTACAAAATCGACAGCAGGGAAGTGTTTTACGACACTAATCTATCGTATGCCTTGGTTAATTTGCGCTCTGTTGTTTCTGGTACCGTTCTTACTCTCTTCCAAAAGGTTGGCAGTCGGCTTGAGAGCTACCACAAAGCAACATCTCTAACACTGATGATTCAAGTGGATATTGCTGCTGGGGGATGGCATTCTACTGCACTAACAGATGATGGAGAGGTGTATGGATGGGGCCGAGGGGAACATGGTAGACTTGGTTTCGGCGATAATGATAAGAGCAGTAAAATGGTCCCGCAAAAGGTTCATCTTTTAGCTGGGGAGGATATCGTTCAGGTGTCTTGTGGAGGCACTCACTCTGCTGCATTAACACGTGATGGGCGCATTTTCTCGATATTTTGTAAGGAGCCATTCTTCTATGGACATGATAACTACGATCAGCTAGTGAAACTAGCAAAGGAGGCTTGCAACAACACTAGAGTAATTGGTACGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RCC1

Protein Analysis

182

Amino Acids

19.93

Weight (kDa)

6.64

Isoelectric Point (pI)

38.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WD40_RLD PF25390 73 - 154 1.1e-22 RCC1-like domain
RCC1_2 PF13540 74 - 101 1.3e-10 Regulator of chromosome condensation (RCC1) repeat
RCC1 PF00415 89 - 140 2.2e-17 Regulator of chromosome condensation (RCC1) repeat
RCC1_2 PF13540 127 - 148 2.8e-06 Regulator of chromosome condensation (RCC1) repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000689)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g08040
malus_domestica MD09G1245800.v1.1 MD11G1098500.v1.1 MD16G1237300.v1.1
pyrus_communis pycom03g07090 pycom03g07100 pycom09g08560 pycom13g20460 pycom16g19890
rosa_chinensis RchiOBHm_Chr2g0118961 RchiOBHm_Chr2g0148671 RchiOBHm_Chr2g0150531 RchiOBHm_Chr2g0171301 RchiOBHm_Chr3g0455021 RchiOBHm_Chr6g0249451
rosa_laevigata RLG00000001225 RLG00000001972 RLG00000008936 RLG00000009011 RLG00000009032 RLG00000015372 RLG00000019992 RLG00000020680 RLG00000026543
rosa_multiflora Rmu_co8272705.1_g000001 Rmu_co8286409.1_g000001 Rmu_sc0000048.1_g000034 Rmu_sc0000824.1_g000002 Rmu_sc0001839.1_g000023 Rmu_sc0002070.1_g000050 Rmu_sc0002349.1_g000005 Rmu_sc0002453.1_g000019 Rmu_sc0006431.1_g000026 Rmu_sc0006758.1_g000001 Rmu_sc0006758.1_g000013 Rmu_sc0006997.1_g000015 Rmu_sc0008411.1_g000007 Rmu_sc0008411.1_g000019 Rmu_sc0008411.1_g000028 Rmu_sc0008678.1_g000001
rosa_roxburghii Rroxscaffold_3G00225850 Rroxscaffold_3G00225860 Rroxscaffold_3G00233460 Rroxscaffold_3G00234260 Rroxscaffold_3G00236880 Rroxscaffold_3G00236890 Rroxscaffold_4G00294300 Rroxscaffold_4G00297380 Rroxscaffold_4G00324650 Rroxscaffold_5G00352840 Rroxscaffold_5G00354640 Rroxscaffold_5G00361500 Rroxscaffold_7G00156410 Rroxscaffold_7G00156420 Rroxscaffold_7G00198110 Rroxscaffold_7G00198120
rosa_samantha Rh1CG014400 Rh1DG009900 Rh2AG465900 Rh2BG342900 Rh2CG452400 Rh2DG488000 Rh3DG303300 Rh4AG118000 Rh4DG159500 Rh5AG246100 Rh6AG232100 Rh6BG178700 Rh6DG174100 Rh7BG231200 Rh7DG380300
rosa_wichuraiana Rw2G027640 Rw2G038070 Rw6G005920 Rw7G034430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 137
AccB1I GGYRCC 1 cut(s) 137
AccI GTMKAC 1 cut(s) 304
AciI CCGC 1 cut(s) 347
AclWI GGATC 1 cut(s) 61
AcvI CACGTG 1 cut(s) 425
AfaI GTAC 3 cut(s) 59, 139, 541
AfiI CCNNNNNNNGG 1 cut(s) 352
AflIII ACRYGT 1 cut(s) 422
AgsI TTSAA 1 cut(s) 218
AjnI CCWGG 1 cut(s) 12
AluBI AGCT 3 cut(s) 183, 368, 493
AluI AGCT 3 cut(s) 183, 368, 493
AlwI GGATC 1 cut(s) 61
AoxI GGCC 2 cut(s) 15, 286
ApeKI GCWGC 2 cut(s) 230, 413
Asp718I GGTACC 1 cut(s) 137
AspLEI GCGC 2 cut(s) 123, 435
AspS9I GGNCC 2 cut(s) 286, 343
AvaII GGWCC 1 cut(s) 343
BanI GGYRCC 1 cut(s) 137
BbrPI CACGTG 1 cut(s) 425
BbvI GCAGC 2 cut(s) 217, 400
BccI CCATC 5 cut(s) 22, 234, 260, 276, 422
BciT130I CCWGG 1 cut(s) 14
BfaI CTAG 3 cut(s) 494, 503, 528
BisI GCNGC 2 cut(s) 231, 414
BlsI GCNGC 2 cut(s) 232, 415
Bme1390I CCNGG 1 cut(s) 14
Bme18I GGWCC 1 cut(s) 343
BmgT120I GGNCC 2 cut(s) 286, 343
BmiI GGNNCC 4 cut(s) 139, 287, 345, 459
BmrFI CCNGG 1 cut(s) 14
BpuEI CTTGAG 1 cut(s) 197
BsaAI YACGTR 2 cut(s) 425, 543
BsaJI CCNNGG 2 cut(s) 108, 289
Bsc4I CCNNNNNNNGG 1 cut(s) 352
BseBI CCWGG 1 cut(s) 14
BseDI CCNNGG 2 cut(s) 108, 289
BseGI GGATG 2 cut(s) 245, 287
BseLI CCNNNNNNNGG 1 cut(s) 352
BseXI GCAGC 2 cut(s) 217, 400
BseYI CCCAGC 2 cut(s) 233, 368
BsgI GTGCAG 1 cut(s) 237
BshFI GGCC 2 cut(s) 17, 288
BshNI GGYRCC 1 cut(s) 137
BslFI GGGAC 1 cut(s) 329
BslI CCNNNNNNNGG 1 cut(s) 352
BsmFI GGGAC 1 cut(s) 329
BsmI GAATGC 1 cut(s) 244
BsnI GGCC 2 cut(s) 17, 288
Bsp143I GATC 2 cut(s) 53, 487
BspACI CCGC 1 cut(s) 347
BspANI GGCC 2 cut(s) 17, 288
BspLI GGNNCC 4 cut(s) 139, 287, 345, 459
BspPI GGATC 1 cut(s) 61
BspT107I GGYRCC 1 cut(s) 137
BssECI CCNNGG 2 cut(s) 108, 289
BssMI GATC 2 cut(s) 53, 487
BssT1I CCWWGG 1 cut(s) 108
Bst2UI CCWGG 1 cut(s) 14
Bst4CI ACNGT 1 cut(s) 142
Bst6I CTCTTC 1 cut(s) 158
BstBAI YACGTR 2 cut(s) 425, 543
BstC8I GCNNGC 1 cut(s) 517
BstF5I GGATG 2 cut(s) 245, 287
BstHHI GCGC 2 cut(s) 123, 435
BstKTI GATC 2 cut(s) 56, 490
BstMBI GATC 2 cut(s) 53, 487
BstMWI GCNNNNNNNGC 1 cut(s) 512
BstNI CCWGG 1 cut(s) 14
BstSCI CCNGG 1 cut(s) 12
BstV1I GCAGC 2 cut(s) 217, 400
BstXI CCANNNNNNTGG 3 cut(s) 28, 50, 164
BsuRI GGCC 2 cut(s) 17, 288
BtsCI GGATG 2 cut(s) 245, 287
BtsIMutI CAGTG 1 cut(s) 206
Cac8I GCNNGC 1 cut(s) 517
CfoI GCGC 2 cut(s) 123, 435
Cfr13I GGNCC 2 cut(s) 286, 343
Csp6I GTAC 3 cut(s) 58, 138, 540
CviAII CATG 2 cut(s) 299, 476
CviJI RGCY 9 cut(s) 17, 32, 175, 183, 288, 368, 460, 493, 515
CviKI_1 RGCY 9 cut(s) 17, 32, 175, 183, 288, 368, 460, 493, 515
CviQI GTAC 3 cut(s) 58, 138, 540
DpnI GATC 2 cut(s) 55, 489
DpnII GATC 2 cut(s) 53, 487
Eam1104I CTCTTC 1 cut(s) 158
EarI CTCTTC 1 cut(s) 158
Eco130I CCWWGG 1 cut(s) 108
Eco147I AGGCCT 1 cut(s) 17
Eco32I GATATC 1 cut(s) 379
Eco47I GGWCC 1 cut(s) 343
Eco72I CACGTG 1 cut(s) 425
EcoRII CCWGG 1 cut(s) 12
EcoRV GATATC 1 cut(s) 379
EcoT14I CCWWGG 1 cut(s) 108
ErhI CCWWGG 1 cut(s) 108
FaeI CATG 2 cut(s) 302, 479
FaiI YATR 6 cut(s) 45, 105, 279, 300, 471, 477
FaqI GGGAC 1 cut(s) 329
FatI CATG 2 cut(s) 298, 475
FauI CCCGC 1 cut(s) 354
FblI GTMKAC 1 cut(s) 304
Fnu4HI GCNGC 2 cut(s) 231, 414
FokI GGATG 2 cut(s) 252, 294
Fsp4HI GCNGC 2 cut(s) 231, 414
FspBI CTAG 3 cut(s) 494, 503, 528
GlaI GCGC 2 cut(s) 122, 434
GluI GCNGC 2 cut(s) 231, 414
GsaI CCCAGC 2 cut(s) 237, 372
HaeIII GGCC 2 cut(s) 17, 288
HhaI GCGC 2 cut(s) 123, 435
Hin1II CATG 2 cut(s) 302, 479
Hin6I GCGC 2 cut(s) 121, 433
HinP1I GCGC 2 cut(s) 121, 433
HinfI GANTC 2 cut(s) 38, 214
Hpy166II GTNNAC 1 cut(s) 305
Hpy188III TCNNGA 1 cut(s) 442
Hpy8I GTNNAC 1 cut(s) 305
HpyCH4III ACNGT 1 cut(s) 142
HpyCH4IV ACGT 2 cut(s) 424, 542
HpyCH4V TGCA 3 cut(s) 254, 416, 519
HpyF10VI GCNNNNNNNGC 1 cut(s) 512
HpySE526I ACGT 2 cut(s) 424, 542
Hsp92II CATG 2 cut(s) 302, 479
HspAI GCGC 2 cut(s) 121, 433
KpnI GGTACC 1 cut(s) 141
Kzo9I GATC 2 cut(s) 53, 487
LmnI GCTCC 1 cut(s) 457
LpnPI CCDG 6 cut(s) 26, 58, 120, 219, 354, 371
Lsp1109I GCAGC 2 cut(s) 217, 400
MaeI CTAG 3 cut(s) 494, 503, 528
MaeII ACGT 2 cut(s) 424, 542
MalI GATC 2 cut(s) 55, 489
MboI GATC 2 cut(s) 53, 487
MboII GAAGA 2 cut(s) 145, 457
MluCI AATT 2 cut(s) 115, 534
MnlI CCTC 6 cut(s) 28, 265, 284, 367, 392, 505
MseI TTAA 2 cut(s) 114, 419
MslI CAYNNNNRTG 1 cut(s) 26
MspR9I CCNGG 1 cut(s) 14
Mva1269I GAATGC 1 cut(s) 244
MvaI CCWGG 1 cut(s) 14
MwoI GCNNNNNNNGC 1 cut(s) 512
NdeII GATC 2 cut(s) 53, 487
NlaIII CATG 2 cut(s) 302, 479
NlaIV GGNNCC 4 cut(s) 139, 287, 345, 459
NmeAIII GCCGAG 1 cut(s) 314
PceI AGGCCT 1 cut(s) 17
PctI GAATGC 1 cut(s) 244
PfeI GAWTC 2 cut(s) 38, 214
PkrI GCNGC 2 cut(s) 232, 415
PmaCI CACGTG 1 cut(s) 425
PmlI CACGTG 1 cut(s) 425
Ppu21I YACGTR 2 cut(s) 425, 543
Psp6I CCWGG 1 cut(s) 12
PspCI CACGTG 1 cut(s) 425
PspFI CCCAGC 2 cut(s) 233, 368
PspGI CCWGG 1 cut(s) 12
PspN4I GGNNCC 4 cut(s) 139, 287, 345, 459
PspPI GGNCC 2 cut(s) 286, 343
RsaI GTAC 3 cut(s) 59, 139, 541
RsaNI GTAC 3 cut(s) 58, 138, 540
RseI CAYNNNNRTG 1 cut(s) 26
SaqAI TTAA 2 cut(s) 114, 419
SatI GCNGC 2 cut(s) 231, 414
Sau3AI GATC 2 cut(s) 53, 487
Sau96I GGNCC 2 cut(s) 286, 343
ScrFI CCNGG 1 cut(s) 14
SetI ASST 9 cut(s) 165, 185, 276, 357, 370, 390, 427, 495, 545
SinI GGWCC 1 cut(s) 343
SmiMI CAYNNNNRTG 1 cut(s) 26
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
Sse9I AATT 2 cut(s) 115, 534
SseBI AGGCCT 1 cut(s) 17
SsiI CCGC 1 cut(s) 347
SspMI CTAG 3 cut(s) 494, 503, 528
StuI AGGCCT 1 cut(s) 17
StyD4I CCNGG 1 cut(s) 12
StyI CCWWGG 1 cut(s) 108
TaaI ACNGT 1 cut(s) 142
TaiI ACGT 2 cut(s) 427, 545
TaqI TCGA 2 cut(s) 66, 443
TasI AATT 2 cut(s) 115, 534
TfiI GAWTC 2 cut(s) 38, 214
Tru1I TTAA 2 cut(s) 114, 419
Tru9I TTAA 2 cut(s) 114, 419
TscAI CASTG 1 cut(s) 213
TseI GCWGC 2 cut(s) 230, 413
TspDTI ATGAA 1 cut(s) 347
TspRI CASTG 1 cut(s) 213
VpaK11BI GGWCC 1 cut(s) 343
XcmI CCANNNNNNNNNTGG 1 cut(s) 31
XmiI GTMKAC 1 cut(s) 304
XspI CTAG 3 cut(s) 494, 503, 528
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.