pycom10g08490

Deoxycytidyl transferase involved in DNA repair. Transfers a dCMP residue from dCTP to the 3'-end of a DNA primer in a template-dependent reaction. May assist in the first step in the bypass of abasic lesions by the insertion of a nucleotide opposite the lesion. Required for normal induction of mutations by physical and chemical agents

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Reverse (-)
11165869 .. 11167101
1233 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g08490.2

Sequence Viewer

Length: 243 bp
ATGGACTCAGATGTGGATGATTATTTACATCAACTTCCAATCAAGGAACTTCCAGGTATAGGACACACTTTAGAGCAGAAGTTGAAGAAACAAAATGTTCAGACGTGTGGACGGTTGCGTATGATTTCAAAGGATTGCAAGTCTATTGGTGCTGAAGAGAATTGGGGCGTGAGGTTCAAGGATTGGAAAGATGTCGGTAGTCTGTTAAACTGTTTTAAAAGGGAACTATTCCTGACATTCTAA

Protein Analysis

81

Amino Acids

9.31

Weight (kDa)

7.72

Isoelectric Point (pI)

18.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000565)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 174
AfiI CCNNNNNNNGG 1 cut(s) 59
AflIII ACRYGT 1 cut(s) 104
AgsI TTSAA 3 cut(s) 85, 129, 178
AjiI CACGTC 1 cut(s) 105
AjnI CCWGG 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 54
Bme1390I CCNGG 1 cut(s) 54
BmgBI CACGTC 1 cut(s) 105
BmrFI CCNGG 1 cut(s) 54
Bsc4I CCNNNNNNNGG 1 cut(s) 59
BseBI CCWGG 1 cut(s) 54
BseGI GGATG 1 cut(s) 22
BseLI CCNNNNNNNGG 1 cut(s) 59
BseMII CTCAG 1 cut(s) 21
BslI CCNNNNNNNGG 1 cut(s) 59
BspCNI CTCAG 1 cut(s) 20
Bst2UI CCWGG 1 cut(s) 54
Bst4CI ACNGT 2 cut(s) 114, 212
Bst6I CTCTTC 1 cut(s) 150
BstDEI CTNAG 1 cut(s) 7
BstF5I GGATG 1 cut(s) 22
BstNI CCWGG 1 cut(s) 54
BstSCI CCNGG 1 cut(s) 52
BtrI CACGTC 1 cut(s) 105
BtsCI GGATG 1 cut(s) 22
DdeI CTNAG 1 cut(s) 7
DraI TTTAAA 1 cut(s) 217
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
Eco57I CTGAAG 1 cut(s) 174
EcoRII CCWGG 1 cut(s) 52
FaiI YATR 2 cut(s) 59, 122
FokI GGATG 1 cut(s) 29
HinfI GANTC 1 cut(s) 5
Hpy166II GTNNAC 1 cut(s) 110
Hpy188I TCNGA 2 cut(s) 10, 102
Hpy188III TCNNGA 1 cut(s) 232
Hpy8I GTNNAC 1 cut(s) 110
HpyCH4III ACNGT 2 cut(s) 114, 212
HpyCH4IV ACGT 1 cut(s) 104
HpyCH4V TGCA 1 cut(s) 138
HpyF3I CTNAG 1 cut(s) 7
HpySE526I ACGT 1 cut(s) 104
LpnPI CCDG 2 cut(s) 39, 66
MaeII ACGT 1 cut(s) 104
MboII GAAGA 2 cut(s) 97, 167
MluCI AATT 1 cut(s) 160
MnlI CCTC 1 cut(s) 165
MseI TTAA 2 cut(s) 206, 216
MspR9I CCNGG 1 cut(s) 54
MvaI CCWGG 1 cut(s) 54
Psp6I CCWGG 1 cut(s) 52
PspGI CCWGG 1 cut(s) 52
SaqAI TTAA 2 cut(s) 206, 216
ScrFI CCNGG 1 cut(s) 54
SetI ASST 3 cut(s) 58, 107, 176
SgeI CNNG 7 cut(s) 55, 65, 66, 117, 151, 181, 190
Sse9I AATT 1 cut(s) 160
StyD4I CCNGG 1 cut(s) 52
TaaI ACNGT 2 cut(s) 114, 212
TaiI ACGT 1 cut(s) 107
TasI AATT 1 cut(s) 160
Tru1I TTAA 2 cut(s) 206, 216
Tru9I TTAA 2 cut(s) 206, 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.