Rh5CG251900

Deoxycytidyl transferase involved in DNA repair. Transfers a dCMP residue from dCTP to the 3'-end of a DNA primer in a template-dependent reaction. May assist in the first step in the bypass of abasic lesions by the insertion of a nucleotide opposite the lesion. Required for normal induction of mutations by physical and chemical agents

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
26541399 .. 26542321
923 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG251900.1

Sequence Viewer

Length: 219 bp
ATGCTTGCTGCTGTACGTCATTCTGATAATCCAAAGGACACTGTTGAAGTTTCCTCTGCAAACTACTCTTCTCGAGATTATGGAGTGAGGGCTGCGATGTTTGTCAGAGATGCTAAGGCTCTTTGTCCACAACTTGTCATTTTTCCTTATGATTTTGAAGCGTATGAGGAGGTAGCTGATAGTTCTATGACATTCTACATAAGCACTGAAGAAAAGTAA

Protein Analysis

72

Amino Acids

8.13

Weight (kDa)

4.57

Isoelectric Point (pI)

47.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
IMS PF00817 11 - 65 4.8e-13 impB/mucB/samB family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000565)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 15
AgsI TTSAA 2 cut(s) 47, 158
AluBI AGCT 1 cut(s) 176
AluI AGCT 1 cut(s) 176
Ama87I CYCGRG 1 cut(s) 72
ApeKI GCWGC 2 cut(s) 8, 92
AvaI CYCGRG 1 cut(s) 72
BbvI GCAGC 1 cut(s) 79
BisI GCNGC 2 cut(s) 9, 93
BlsI GCNGC 2 cut(s) 10, 94
BmeT110I CYCGRG 1 cut(s) 72
BmsI GCATC 1 cut(s) 100
Bpu10I CCTNAGC 1 cut(s) 114
BseRI GAGGAG 1 cut(s) 182
BseXI GCAGC 1 cut(s) 79
BsiHKCI CYCGRG 1 cut(s) 72
BsoBI CYCGRG 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 43
Bst6I CTCTTC 1 cut(s) 73
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 114
BstV1I GCAGC 1 cut(s) 79
BtgZI GCGATG 1 cut(s) 110
BtsIMutI CAGTG 2 cut(s) 39, 204
Cac8I GCNNGC 1 cut(s) 6
Csp6I GTAC 1 cut(s) 14
CviJI RGCY 3 cut(s) 92, 119, 176
CviKI_1 RGCY 3 cut(s) 92, 119, 176
CviQI GTAC 1 cut(s) 14
DdeI CTNAG 1 cut(s) 114
Eam1104I CTCTTC 1 cut(s) 73
EarI CTCTTC 1 cut(s) 73
Eco88I CYCGRG 1 cut(s) 72
FaiI YATR 5 cut(s) 81, 150, 165, 188, 200
Fnu4HI GCNGC 2 cut(s) 9, 93
Fsp4HI GCNGC 2 cut(s) 9, 93
GluI GCNGC 2 cut(s) 9, 93
Hpy166II GTNNAC 1 cut(s) 128
Hpy188I TCNGA 2 cut(s) 25, 107
Hpy188III TCNNGA 2 cut(s) 72, 74
Hpy8I GTNNAC 1 cut(s) 128
HpyCH4III ACNGT 1 cut(s) 43
HpyCH4IV ACGT 1 cut(s) 16
HpyCH4V TGCA 1 cut(s) 59
HpyF3I CTNAG 1 cut(s) 114
HpySE526I ACGT 1 cut(s) 16
Lsp1109I GCAGC 1 cut(s) 79
LweI GCATC 1 cut(s) 100
MaeII ACGT 1 cut(s) 16
MboII GAAGA 1 cut(s) 60
MnlI CCTC 4 cut(s) 64, 81, 160, 163
PaeR7I CTCGAG 1 cut(s) 72
PkrI GCNGC 2 cut(s) 10, 94
RsaI GTAC 1 cut(s) 15
RsaNI GTAC 1 cut(s) 14
SatI GCNGC 2 cut(s) 9, 93
SetI ASST 3 cut(s) 19, 174, 178
SfaNI GCATC 1 cut(s) 100
Sfr274I CTCGAG 1 cut(s) 72
SgeI CNNG 4 cut(s) 17, 84, 86, 146
SlaI CTCGAG 1 cut(s) 72
SmlI CTYRAG 1 cut(s) 72
SmoI CTYRAG 1 cut(s) 72
TaaI ACNGT 1 cut(s) 43
TaiI ACGT 1 cut(s) 19
TaqI TCGA 1 cut(s) 73
TscAI CASTG 2 cut(s) 46, 211
TseI GCWGC 2 cut(s) 8, 92
TspRI CASTG 2 cut(s) 46, 211
XhoI CTCGAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.