Rh4CG141900

Deoxycytidyl transferase involved in DNA repair. Transfers a dCMP residue from dCTP to the 3'-end of a DNA primer in a template-dependent reaction. May assist in the first step in the bypass of abasic lesions by the insertion of a nucleotide opposite the lesion. Required for normal induction of mutations by physical and chemical agents

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
28348467 .. 28349582
1116 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG141900.1

Sequence Viewer

Length: 255 bp
ATGCTGAGGCTTGCTGTTGTACGTCATTCTGATAATCCAAAGGACACTGCTGAAGTTTCCTCTGCAAACTACTCTGCTCGAGATTATGGAGTGAGGGCTGCGATGTTTGTCAGAGATGCTAAGGCTCTTTGTCCACAACTTGTCATTTTTCCTTATGATTTTGAAGCGTATGAGGAGGTAGCTGATAGTTCTATGACATTCTACATAAGCACTGAAGAAAAATGGGTTCACAATTCAAGGGTTATATATGATTGA

Protein Analysis

84

Amino Acids

9.66

Weight (kDa)

5.02

Isoelectric Point (pI)

47.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
IMS PF00817 5 - 69 5.9e-15 impB/mucB/samB family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000565)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 72, 234
AfaI GTAC 1 cut(s) 21
AgsI TTSAA 2 cut(s) 164, 237
AluBI AGCT 1 cut(s) 182
AluI AGCT 1 cut(s) 182
Ama87I CYCGRG 1 cut(s) 78
ApeKI GCWGC 1 cut(s) 98
AvaI CYCGRG 1 cut(s) 78
BbvCI CCTCAGC 1 cut(s) 5
BbvI GCAGC 1 cut(s) 85
BisI GCNGC 1 cut(s) 99
BlsI GCNGC 1 cut(s) 100
BmeT110I CYCGRG 1 cut(s) 78
BmsI GCATC 1 cut(s) 106
Bpu10I CCTNAGC 2 cut(s) 5, 120
BseRI GAGGAG 1 cut(s) 188
BseXI GCAGC 1 cut(s) 85
BsiHKCI CYCGRG 1 cut(s) 78
BsoBI CYCGRG 1 cut(s) 78
BstC8I GCNNGC 1 cut(s) 12
BstDEI CTNAG 2 cut(s) 5, 120
BstV1I GCAGC 1 cut(s) 85
BtgZI GCGATG 1 cut(s) 116
BtsI GCAGTG 1 cut(s) 45
BtsIMutI CAGTG 2 cut(s) 45, 210
Cac8I GCNNGC 1 cut(s) 12
Csp6I GTAC 1 cut(s) 20
CviJI RGCY 4 cut(s) 10, 98, 125, 182
CviKI_1 RGCY 4 cut(s) 10, 98, 125, 182
CviQI GTAC 1 cut(s) 20
DdeI CTNAG 2 cut(s) 5, 120
Eco57I CTGAAG 2 cut(s) 72, 234
Eco88I CYCGRG 1 cut(s) 78
FaiI YATR 8 cut(s) 87, 156, 171, 194, 206, 245, 247, 249
Fnu4HI GCNGC 1 cut(s) 99
Fsp4HI GCNGC 1 cut(s) 99
GluI GCNGC 1 cut(s) 99
Hpy166II GTNNAC 2 cut(s) 134, 229
Hpy188I TCNGA 2 cut(s) 31, 113
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 2 cut(s) 134, 229
HpyCH4IV ACGT 1 cut(s) 22
HpyCH4V TGCA 1 cut(s) 65
HpyF3I CTNAG 2 cut(s) 5, 120
HpySE526I ACGT 1 cut(s) 22
Lsp1109I GCAGC 1 cut(s) 85
LweI GCATC 1 cut(s) 106
MaeII ACGT 1 cut(s) 22
MboII GAAGA 1 cut(s) 227
MluCI AATT 1 cut(s) 232
MnlI CCTC 4 cut(s) 70, 87, 166, 169
PaeR7I CTCGAG 1 cut(s) 78
PkrI GCNGC 1 cut(s) 100
RsaI GTAC 1 cut(s) 21
RsaNI GTAC 1 cut(s) 20
SatI GCNGC 1 cut(s) 99
SetI ASST 3 cut(s) 25, 180, 184
SfaNI GCATC 1 cut(s) 106
Sfr274I CTCGAG 1 cut(s) 78
SgeI CNNG 5 cut(s) 23, 90, 92, 152, 249
SlaI CTCGAG 1 cut(s) 78
SmlI CTYRAG 1 cut(s) 78
SmoI CTYRAG 1 cut(s) 78
Sse9I AATT 1 cut(s) 232
TaiI ACGT 1 cut(s) 25
TaqI TCGA 1 cut(s) 79
TasI AATT 1 cut(s) 232
TscAI CASTG 2 cut(s) 52, 217
TseI GCWGC 1 cut(s) 98
TspRI CASTG 2 cut(s) 52, 217
XhoI CTCGAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.