pycom10g11300

GDSL esterase lipase At5g55050-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
OG0000448
Physical Location & Seq
Reverse (-)
14795953 .. 14796144
192 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g11300.1

Sequence Viewer

Length: 192 bp
ATGTTGAAGCTCAGCTCCGAATGCAAGGACATCAAGTATGCACTTGGGAATGCATTTGAAATGACAATAAATGTCATTCAGAATCCTTTTCCATTCAGTAAGTCAATACGTACTTTATCTCATTCACCAATTTTATCTCACAAAATATGCATTGCACTCGAGTGTCAAAACCCTGTATTTTGGACCTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lipase_GDSL

Protein Analysis

64

Amino Acids

7.2

Weight (kDa)

8.57

Isoelectric Point (pI)

49.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000448)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g10790 FvH4_1g10790 FvH4_1g10790 FvH4_1g10791 FvH4_1g10800 FvH4_2g15970 FvH4_2g15980 FvH4_2g15990
malus_domestica MD02G1121900.v1.1 MD05G1128700.v1.1 MD10G1131900.v1.1 MD15G1235500.v1.1 MD15G1235600.v1.1
prunus_persica Prupe.7G177500_v2.0.a1 Prupe.7G177600_v2.0.a1 Prupe.8G172800_v2.0.a1
pyrus_communis pycom05g12460 pycom05g12470 pycom10g11300
rosa_chinensis RchiOBHm_Chr2g0097971 RchiOBHm_Chr2g0098021 RchiOBHm_Chr2g0098061 RchiOBHm_Chr6g0257301 RchiOBHm_Chr6g0279511 RchiOBHm_Chr6g0279521
rosa_laevigata RLG00000013139 RLG00000013140 RLG00000013141 RLG00000016747 RLG00000016749 RLG00000016750 RLG00000016751 RLG00000016752
rosa_multiflora Rmu_sc0002648.1_g000005 Rmu_sc0002648.1_g000006 Rmu_sc0004649.1_g000019 Rmu_sc0004649.1_g000021 Rmu_sc0009572.1_g000002 Rmu_sc0013919.1_g000008 Rmu_sc0013919.1_g000009
rosa_roxburghii Rroxscaffold_2G00144370 Rroxscaffold_2G00144380 Rroxscaffold_2G00144390 Rroxscaffold_2G00144410 Rroxscaffold_4G00294600 Rroxscaffold_7G00188840 Rroxscaffold_7G00188850 Rroxscaffold_7G00188860
rosa_rugosa Rorug02G0069400 Rorug02G0069600 Rorug02G0069700 Rorug02G0069800 Rorug06G0098000.1 Rorug06G0125000 Rorug06G0125100 Rorug06G0125200
rosa_samantha Rh2AG116400 Rh2AG116800 Rh2AG116900 Rh2AG117000 Rh2BG119300 Rh2BG119500 Rh2BG119600 Rh2BG119700 Rh2BG119800 Rh2CG120900 Rh2CG121000 Rh2CG121200 Rh2CG121300 Rh2CG121400 Rh2CG121500 Rh2DG120600 Rh2DG121100 Rh2DG121200 Rh2DG121500 Rh6AG091200 Rh6AG234100 Rh6BG238400 Rh6BG238500 Rh6BG238600 Rh6CG078800 Rh6CG240400 Rh6CG240500 Rh6CG240600 Rh6DG074600 Rh6DG232000 Rh6DG232100
rosa_wichuraiana Rw2G009120 Rw2G009130 Rw2G009140 Rw6G020420 Rw6G020430 Rw6G020440

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 112
AgsI TTSAA 2 cut(s) 7, 59
AleI CACNNNNGTG 1 cut(s) 160
AluBI AGCT 2 cut(s) 10, 15
AluI AGCT 2 cut(s) 10, 15
Ama87I CYCGRG 1 cut(s) 158
AspS9I GGNCC 1 cut(s) 183
AsuHPI GGTGA 1 cut(s) 117
AvaI CYCGRG 1 cut(s) 158
AvaII GGWCC 1 cut(s) 183
BcgI CGANNNNNNTGC 2 cut(s) 139, 173
BlpI GCTNAGC 1 cut(s) 11
Bme18I GGWCC 1 cut(s) 183
BmeT110I CYCGRG 1 cut(s) 158
BmgT120I GGNCC 1 cut(s) 183
Bpu1102I GCTNAGC 1 cut(s) 11
BsaAI YACGTR 1 cut(s) 110
Bse3DI GCAATG 1 cut(s) 150
BseMI GCAATG 1 cut(s) 150
BseMII CTCAG 1 cut(s) 25
BsiHKCI CYCGRG 1 cut(s) 158
BsmI GAATGC 2 cut(s) 26, 55
BsoBI CYCGRG 1 cut(s) 158
Bsp1720I GCTNAGC 1 cut(s) 11
BspCNI CTCAG 1 cut(s) 24
BsrDI GCAATG 1 cut(s) 150
BstBAI YACGTR 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 11
BstMWI GCNNNNNNNGC 1 cut(s) 21
BstSNI TACGTA 1 cut(s) 110
Cfr13I GGNCC 1 cut(s) 183
Csp6I GTAC 1 cut(s) 111
CviJI RGCY 2 cut(s) 10, 15
CviKI_1 RGCY 2 cut(s) 10, 15
CviQI GTAC 1 cut(s) 111
DdeI CTNAG 1 cut(s) 11
Eco105I TACGTA 1 cut(s) 110
Eco47I GGWCC 1 cut(s) 183
Eco88I CYCGRG 1 cut(s) 158
EcoT22I ATGCAT 2 cut(s) 55, 152
FaiI YATR 2 cut(s) 39, 148
HinfI GANTC 1 cut(s) 82
HphI GGTGA 1 cut(s) 117
Hpy188I TCNGA 2 cut(s) 19, 81
HpyCH4IV ACGT 1 cut(s) 109
HpyCH4V TGCA 5 cut(s) 24, 41, 53, 150, 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 21
HpyF3I CTNAG 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 109
LmnI GCTCC 1 cut(s) 20
LpnPI CCDG 1 cut(s) 186
MaeII ACGT 1 cut(s) 109
MluCI AATT 1 cut(s) 129
Mph1103I ATGCAT 2 cut(s) 55, 152
MslI CAYNNNNRTG 1 cut(s) 160
Mva1269I GAATGC 2 cut(s) 26, 55
MwoI GCNNNNNNNGC 1 cut(s) 21
NsiI ATGCAT 2 cut(s) 55, 152
OliI CACNNNNGTG 1 cut(s) 160
PaeR7I CTCGAG 1 cut(s) 158
PctI GAATGC 2 cut(s) 26, 55
PfeI GAWTC 1 cut(s) 82
Ppu21I YACGTR 1 cut(s) 110
PspPI GGNCC 1 cut(s) 183
PspXI VCTCGAGB 1 cut(s) 158
RsaI GTAC 1 cut(s) 112
RsaNI GTAC 1 cut(s) 111
RseI CAYNNNNRTG 1 cut(s) 160
Sau96I GGNCC 1 cut(s) 183
SetI ASST 4 cut(s) 12, 17, 112, 188
Sfr274I CTCGAG 1 cut(s) 158
SgeI CNNG 6 cut(s) 37, 46, 56, 170, 172, 185
SinI GGWCC 1 cut(s) 183
SlaI CTCGAG 1 cut(s) 158
SmiMI CAYNNNNRTG 1 cut(s) 160
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
SnaBI TACGTA 1 cut(s) 110
Sse9I AATT 1 cut(s) 129
TaiI ACGT 1 cut(s) 112
TaqI TCGA 1 cut(s) 159
TasI AATT 1 cut(s) 129
TfiI GAWTC 1 cut(s) 82
VpaK11BI GGWCC 1 cut(s) 183
XhoI CTCGAG 1 cut(s) 158
Zsp2I ATGCAT 2 cut(s) 55, 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.