pycom15g03820

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0000563
Physical Location & Seq
Forward (+)
2337795 .. 2337989
195 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g03820.1

Sequence Viewer

Length: 195 bp
ATGTCGAACAAGGATTGCTATTATTGCATTCAGCTTATGGGGCGAGTTTGCAGCCTCAACATCAGTCAGCTTTTATTTAAGAAGGGATCTACTTCTAAGAGGCCCGAATTCAAAAATGTGTTTGTCAACGCAAATGTTGAATTTCCGGATGGGACTAGTTATCAGGGATTCCAAATTGCATTTTGTTGGGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.31

Weight (kDa)

8.8

Isoelectric Point (pI)

39.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 145
AclWI GGATC 1 cut(s) 94
AcsI RAATTY 2 cut(s) 107, 140
AgsI TTSAA 2 cut(s) 112, 140
AhlI ACTAGT 1 cut(s) 155
AluBI AGCT 2 cut(s) 34, 70
AluI AGCT 2 cut(s) 34, 70
AlwI GGATC 1 cut(s) 94
Aor13HI TCCGGA 1 cut(s) 145
AoxI GGCC 1 cut(s) 101
ApeKI GCWGC 1 cut(s) 51
ApoI RAATTY 2 cut(s) 107, 140
AspS9I GGNCC 1 cut(s) 102
BbvI GCAGC 1 cut(s) 63
BccI CCATC 1 cut(s) 143
BcuI ACTAGT 1 cut(s) 155
BfaI CTAG 1 cut(s) 156
BisI GCNGC 1 cut(s) 52
BlsI GCNGC 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 102
BsaWI WCCGGW 1 cut(s) 145
BseAI TCCGGA 1 cut(s) 145
BseGI GGATG 1 cut(s) 154
BseXI GCAGC 1 cut(s) 63
BshFI GGCC 1 cut(s) 103
BsiSI CCGG 1 cut(s) 146
BslFI GGGAC 1 cut(s) 166
BsmFI GGGAC 1 cut(s) 166
BsmI GAATGC 1 cut(s) 27
BsnI GGCC 1 cut(s) 103
Bsp13I TCCGGA 1 cut(s) 145
Bsp143I GATC 1 cut(s) 86
BspANI GGCC 1 cut(s) 103
BspEI TCCGGA 1 cut(s) 145
BspPI GGATC 1 cut(s) 94
BssMI GATC 1 cut(s) 86
BstDEI CTNAG 1 cut(s) 96
BstF5I GGATG 1 cut(s) 154
BstKTI GATC 1 cut(s) 89
BstMBI GATC 1 cut(s) 86
BstMWI GCNNNNNNNGC 2 cut(s) 24, 40
BstV1I GCAGC 1 cut(s) 63
BstX2I RGATCY 1 cut(s) 86
BstYI RGATCY 1 cut(s) 86
BsuRI GGCC 1 cut(s) 103
BtsCI GGATG 1 cut(s) 154
Cfr13I GGNCC 1 cut(s) 102
CviJI RGCY 4 cut(s) 34, 54, 70, 103
CviKI_1 RGCY 4 cut(s) 34, 54, 70, 103
DdeI CTNAG 1 cut(s) 96
DpnI GATC 1 cut(s) 88
DpnII GATC 1 cut(s) 86
EcoRI GAATTC 1 cut(s) 107
FaiI YATR 1 cut(s) 38
FaqI GGGAC 1 cut(s) 166
Fnu4HI GCNGC 1 cut(s) 52
FokI GGATG 1 cut(s) 161
Fsp4HI GCNGC 1 cut(s) 52
FspBI CTAG 1 cut(s) 156
GluI GCNGC 1 cut(s) 52
HaeIII GGCC 1 cut(s) 103
HapII CCGG 1 cut(s) 146
HincII GTYRAC 1 cut(s) 127
HindII GTYRAC 1 cut(s) 127
HinfI GANTC 1 cut(s) 168
HpaII CCGG 1 cut(s) 146
Hpy166II GTNNAC 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 146
Hpy8I GTNNAC 1 cut(s) 127
HpyAV CCTTC 1 cut(s) 76
HpyCH4V TGCA 3 cut(s) 27, 51, 179
HpyF10VI GCNNNNNNNGC 2 cut(s) 24, 40
HpyF3I CTNAG 1 cut(s) 96
Kpn2I TCCGGA 1 cut(s) 145
Kzo9I GATC 1 cut(s) 86
LpnPI CCDG 2 cut(s) 149, 159
Lsp1109I GCAGC 1 cut(s) 63
MaeI CTAG 1 cut(s) 156
MalI GATC 1 cut(s) 88
MboI GATC 1 cut(s) 86
MflI RGATCY 1 cut(s) 86
MluCI AATT 3 cut(s) 107, 140, 174
MnlI CCTC 2 cut(s) 65, 93
MroI TCCGGA 1 cut(s) 145
MseI TTAA 1 cut(s) 78
MspI CCGG 1 cut(s) 146
Mva1269I GAATGC 1 cut(s) 27
MwoI GCNNNNNNNGC 2 cut(s) 24, 40
NdeII GATC 1 cut(s) 86
PctI GAATGC 1 cut(s) 27
PfeI GAWTC 1 cut(s) 168
PkrI GCNGC 1 cut(s) 53
PspPI GGNCC 1 cut(s) 102
PsuI RGATCY 1 cut(s) 86
SaqAI TTAA 1 cut(s) 78
SatI GCNGC 1 cut(s) 52
Sau3AI GATC 1 cut(s) 86
Sau96I GGNCC 1 cut(s) 102
SetI ASST 2 cut(s) 36, 72
SgeI CNNG 6 cut(s) 22, 56, 116, 158, 168, 176
SpeI ACTAGT 1 cut(s) 155
Sse9I AATT 3 cut(s) 107, 140, 174
SspMI CTAG 1 cut(s) 156
TaqI TCGA 1 cut(s) 5
TasI AATT 3 cut(s) 107, 140, 174
TfiI GAWTC 1 cut(s) 168
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TseI GCWGC 1 cut(s) 51
XapI RAATTY 2 cut(s) 107, 140
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.