Rroxscaffold_2G00089010

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0000563
Physical Location & Seq
Forward (+)
10892274 .. 10896313
4040 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00089010.1

Sequence Viewer

Length: 264 bp
ATGATGGTGGCTACTAGCCGGGATGGTAGCTATTGGAATCATACACATCTAACAATGTTTCAAGTTTCCGTCTCAAACGACCTTGAAGGCAATCAAACCCTGTCTGTAGAAATCGAGACTCAAGGAGTTCCTGATTTTCGAACCTTCCAAGTTATTGCTCGTCAACTTTCACCTTGTGCCATCATGTGGACAAGATCGAGTCACACTAGAAAAGCATTATCCAAAAAGGCGCATGCTCGAAACGATAACAAAGAGTTGACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.91

Weight (kDa)

9.03

Isoelectric Point (pI)

30.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 186
AdeI CACNNNGTG 1 cut(s) 176
AfiI CCNNNNNNNGG 1 cut(s) 186
AgsI TTSAA 2 cut(s) 62, 86
AluBI AGCT 1 cut(s) 30
AluI AGCT 1 cut(s) 30
Alw26I GTCTC 2 cut(s) 76, 110
AspLEI GCGC 1 cut(s) 232
AsuC2I CCSGG 1 cut(s) 20
AsuHPI GGTGA 1 cut(s) 162
AsuII TTCGAA 1 cut(s) 139
BccI CCATC 2 cut(s) 17, 188
BcnI CCSGG 1 cut(s) 20
BcoDI GTCTC 2 cut(s) 76, 110
BfaI CTAG 2 cut(s) 15, 207
BfmI CTRYAG 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 20
BmrFI CCNGG 1 cut(s) 20
Bpu14I TTCGAA 1 cut(s) 139
BpuEI CTTGAG 1 cut(s) 105
BpuMI CCSGG 1 cut(s) 20
Bsc4I CCNNNNNNNGG 1 cut(s) 186
BseGI GGATG 1 cut(s) 28
BseLI CCNNNNNNNGG 1 cut(s) 186
BsiSI CCGG 1 cut(s) 19
BslI CCNNNNNNNGG 1 cut(s) 186
BsmAI GTCTC 2 cut(s) 76, 110
BsmBI CGTCTC 1 cut(s) 76
Bsp119I TTCGAA 1 cut(s) 139
Bsp143I GATC 1 cut(s) 194
BspT104I TTCGAA 1 cut(s) 139
BssMI GATC 1 cut(s) 194
BstBI TTCGAA 1 cut(s) 139
BstC8I GCNNGC 1 cut(s) 234
BstF5I GGATG 1 cut(s) 28
BstHHI GCGC 1 cut(s) 232
BstKTI GATC 1 cut(s) 197
BstMAI GTCTC 2 cut(s) 76, 110
BstMBI GATC 1 cut(s) 194
BstNSI RCATGY 1 cut(s) 236
BstSCI CCNGG 1 cut(s) 18
BstSFI CTRYAG 1 cut(s) 105
BtsCI GGATG 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 234
CfoI GCGC 1 cut(s) 232
CviAII CATG 2 cut(s) 184, 233
CviJI RGCY 3 cut(s) 11, 18, 30
CviKI_1 RGCY 3 cut(s) 11, 18, 30
DpnI GATC 1 cut(s) 196
DpnII GATC 1 cut(s) 194
DraIII CACNNNGTG 1 cut(s) 176
Esp3I CGTCTC 1 cut(s) 76
FaeI CATG 2 cut(s) 187, 236
FaiI YATR 4 cut(s) 42, 185, 234, 262
FatI CATG 2 cut(s) 183, 232
FokI GGATG 1 cut(s) 35
FspBI CTAG 2 cut(s) 15, 207
GlaI GCGC 1 cut(s) 231
HapII CCGG 1 cut(s) 19
HhaI GCGC 1 cut(s) 232
Hin1II CATG 2 cut(s) 187, 236
Hin6I GCGC 1 cut(s) 230
HinP1I GCGC 1 cut(s) 230
HincII GTYRAC 2 cut(s) 164, 258
HindII GTYRAC 2 cut(s) 164, 258
HinfI GANTC 3 cut(s) 37, 118, 199
HpaII CCGG 1 cut(s) 19
HphI GGTGA 1 cut(s) 162
Hpy166II GTNNAC 3 cut(s) 164, 189, 258
Hpy188III TCNNGA 2 cut(s) 115, 131
Hpy8I GTNNAC 3 cut(s) 164, 189, 258
HpyAV CCTTC 2 cut(s) 80, 154
Hsp92II CATG 2 cut(s) 187, 236
HspAI GCGC 1 cut(s) 230
Kzo9I GATC 1 cut(s) 194
LpnPI CCDG 3 cut(s) 32, 113, 144
MaeI CTAG 2 cut(s) 15, 207
MaeIII GTNAC 1 cut(s) 200
MalI GATC 1 cut(s) 196
MboI GATC 1 cut(s) 194
MlyI GAGTC 2 cut(s) 112, 208
MspI CCGG 1 cut(s) 19
MspR9I CCNGG 1 cut(s) 20
NciI CCSGG 1 cut(s) 20
NdeII GATC 1 cut(s) 194
NlaIII CATG 2 cut(s) 187, 236
NmuCI GTSAC 1 cut(s) 200
NspI RCATGY 1 cut(s) 236
NspV TTCGAA 1 cut(s) 139
PaeI GCATGC 1 cut(s) 236
PfeI GAWTC 1 cut(s) 37
PflMI CCANNNNNTGG 1 cut(s) 186
PleI GAGTC 2 cut(s) 112, 207
PpsI GAGTC 2 cut(s) 112, 207
Sau3AI GATC 1 cut(s) 194
SchI GAGTC 2 cut(s) 112, 208
ScrFI CCNGG 1 cut(s) 20
SetI ASST 4 cut(s) 32, 84, 146, 175
SfcI CTRYAG 1 cut(s) 105
SfuI TTCGAA 1 cut(s) 139
SmlI CTYRAG 1 cut(s) 120
SmoI CTYRAG 1 cut(s) 120
SphI GCATGC 1 cut(s) 236
SspMI CTAG 2 cut(s) 15, 207
StyD4I CCNGG 1 cut(s) 18
TaqI TCGA 4 cut(s) 114, 139, 197, 238
TfiI GAWTC 1 cut(s) 37
TseFI GTSAC 1 cut(s) 200
Tsp45I GTSAC 1 cut(s) 200
TspGWI ACGGA 1 cut(s) 58
Van91I CCANNNNNTGG 1 cut(s) 186
XceI RCATGY 1 cut(s) 236
XspI CTAG 2 cut(s) 15, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.